UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:FIC1
HGNC Symbol:ATP8B1
HGNC Description:ATPase, aminophospholipid transporter, class I, type 8B, member 1
HGNC ID:3706
Superfamily:None
Chromosome:Chr.18(-): 55313658-55470327 GRCh37
Location:18q21.31
OMIM:602397
OMIM Phenotype:Cholestasis, benign recurrent intrahepatic; Cholestasis, progressive familial intrahepatic-1; Byler disease
Accessions:AF038007
Nucleotide RefSeq:NM_005603
Protein RefSeq:NP_005594
Entrez:5205
Ensembl:ENSG00000081923
Isoforms:1
Evidence:None
Tissues:None
Type:protein-coding
Sets:I
PharmGKB ID:PA265
HPRD ID:03867
Substrates:None
Trivial Names:BRIC, FIC1, ICP1, PFIC, ATPIC, PFIC1
Transcripts:NM_005603.4 [Chr.18(-): 55313658-55470327 GRCh37]
ENST00000283684 [Chr.18(-): 55313658-55399039 GRCh37]
ENST00000536015 [Chr.18(-): 55313661-55470327 GRCh37]
ENST00000585322 [Chr.18(-): 55399007-55408197 GRCh37]
ENST00000588255 [Chr.18(-): 55351350-55355900 GRCh37]
ENST00000589147 [Chr.18(-): 55364902-55375790 GRCh37]
ENST00000591728 [Chr.18(-): 55368321-55470333 GRCh37]
Annotation History:View Events (2)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for ATP8B1.

Variant Data

View all PMT variants for ATP8B1 on UCSC Genome Browser
Showing SNP features for transcript: NM_005603  
ATP8B1 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:ATP8B1 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 PDE
55399070 GRCh37
53550068 NCBI36
 -31
TAATTCACTCTGGTTTCTCTTTCCT T → C TTAAGCAGGTAGTTCCAATTTGCCA
- 
 
n=
T/T=
T/C=
C/C=
C=
200
97
3
0
0.015
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 2: 5UTRPDE
55399045 GRCh37
53550043 NCBI36
115-6
TTTAAGCAGGTAGTTCCAATTTGCC A → C GCAGAATGAGTACAGAAAGAGACTC
- 
 
n=
A/A=
A/C=
C/C=
C=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
55398829 GRCh37
53549827 NCBI36
  
CCACATGAAGTCCCGGTGACTAGGT C → T GCTTATAAATCCTCATGTGGGTCAT
- 
 
n=
C/C=
C/T=
T/T=
T=
200
98
2
0
0.010
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 
55373824 GRCh37
53524822 NCBI36
  
CTTACGAACTTTTCTCCCTTTTTTT T → TT AAAGAATGTACATGGCAAGTCAAAG
- 
 
n=
T/T=
T/TT=
TT/TT=
TT=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 3: CodingPDE
55373812 GRCh37
53524810 NCBI36
309189
TCTCCCTTTTTTTTAAAGAATGTAC A → G TGGCAAGTCAAAGCAAACGATCGCA
-63
Thr = Thr
n=
A/A=
A/G=
G/G=
G=
200
98
2
0
0.010
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 3: CodingPDE2 pubs
55373793 GRCh37
53524791 NCBI36
328208
ATGTACATGGCAAGTCAAAGCAAAC G → A ATCGCAAGTACCACGAACAACCTCA
-70
Asp → Asn
(D=23)
n=
G/G=
G/A=
A/A=
A=
200
99
1
0
0.005
200
98
2
0
0.010
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 3: CodingPDEA
55373767 GRCh37
53524765 NCBI36
354234
ATCGCAAGTACCACGAACAACCTCA C → G TTTATGAACACAAAATTCTTGTGTA
-78
His → Gln
(D=24)
n=
C/C=
C/G=
G/G=
G=
200
100
0
0
0.000
200
100
0
0
0.000
60
27
3
0
0.050
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 3: CodingPDE
55373755 GRCh37
53524753 NCBI36
366246
ACGAACAACCTCACTTTATGAACAC A → G AAATTCTTGTGTATTAAGGAGAGTA
-82
Thr = Thr
n=
A/A=
A/G=
G/G=
G=
200
100
0
0
0.000
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
55368573 GRCh37
53519571 NCBI36
  
GTAAGCTTGATATGCCTTCATGGAC A → C CACACATAAGCCCTTTTATTCTTTT
- 
 
n=
A/A=
A/C=
C/C=
C=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
55368551 GRCh37
53519549 NCBI36
  
GACACACACATAAGCCCTTTTATTC T → C TTTAGGCAGTTCCTCAAATCTCTAC
- 
 
n=
T/T=
T/C=
C/C=
C=
200
100
0
0
0.000
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDEI
55364830 GRCh37
53515828 NCBI36
  
GGACGGGTAAGTGTGTCTCGATGGG C → T CTGATTTAAAGCTGGCCTTTGAAGG
- 
 
n=
C/C=
C/T=
T/T=
T=
198
42
49
8
0.328
190
27
46
22
0.474
60
3
9
18
0.750
20
4
4
2
0.400
14
1
2
4
0.714
Set-I
Exon 9: CodingPDE
55362692 GRCh37
53513690 NCBI36
891771
ACCTCCAAAGAGAAGATACATTGGC T → C ACATTTGATGGTTTGTACCAAACAT
-257
Ala = Ala
n=
T/T=
T/C=
C/C=
C=
200
100
0
0
0.000
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 10: CodingPDEI
55362532 GRCh37
53513530 NCBI36
931811
TATTGAATGTGAAGAACCCAATAAC C → A GACTAGATAAGTTTACAGGAACACT
-271
Arg = Arg
n=
C/C=
C/A=
A/A=
A=
200
99
0
1
0.010
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
55361778 GRCh37
53512776 NCBI36
  
TTCATCTCAGTAGATCTCTCATCTA G → A ATTGCTGTCTTTTGCACTAATATTA
- 
 
n=
G/G=
G/A=
A/A=
A=
200
100
0
0
0.000
200
97
3
0
0.015
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 12: CodingPDE
55359158 GRCh37
53510156 NCBI36
12211101
ATGCTTATTGGGAAGCACAGGTGGG C → A AATTCCTCTTGGTACCTCTATGATG
-367
Gly = Gly
n=
C/C=
C/A=
A/A=
A=
200
100
0
0
0.000
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 12: CodingPDE
55359082 GRCh37
53510080 NCBI36
12971177
TGGATTCCTCATTTTCTGGGGCTAT A → G TCATTGTTCTCAACACCATGGTACC
-393
Ile → Val
(D=29)
n=
A/A=
A/G=
G/G=
G=
200
99
1
0
0.005
200
98
2
0
0.010
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 13: CodingPDE
55355674 GRCh37
53506672 NCBI36
14061286
TGGGACCTGCAAATGTACTATGCTG A → C GAAGGACACACCCGCAAAAGCTAGA
-429
Glu → Ala
(D=107)
n=
A/A=
A/C=
C/C=
C=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
55352288 GRCh37
53503286 NCBI36
  
CAAAATAGAGGTAAGACCTTTAAGC C → T GAAGAATCGTTTGGGATGCTGGGGA
- 
 
n=
C/C=
C/T=
T/T=
T=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
55342291 GRCh37
53493289 NCBI36
  
CAACAATGAGCTCTGCATTTGTTTT T → C ACAGCTTTTCTGGGATTTCTCTCGC
- 
 
n=
T/T=
T/C=
C/C=
C=
200
100
0
0
0.000
200
96
4
0
0.020
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 16: CodingPDE
55342174 GRCh37
53493172 NCBI36
18311711
CAGGAACTTTGGCTTTGCCTTCCTC G → A CCAGGACCCAGAACACCATCACCAT
-571
Ala → Thr
(D=58)
n=
G/G=
G/A=
A/A=
A=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 16: CodingPDEI
55342156 GRCh37
53493154 NCBI36
18491729
CTTCCTCGCCAGGACCCAGAACACC A → G TCACCATCAGTGAACTGGGCACTGA
-577
Ile → Val
(D=29)
n=
A/A=
A/G=
G/G=
G=
200
100
0
0
0.000
200
100
0
0
0.000
60
28
2
0
0.033
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 16: CodingPDE
55342146 GRCh37
53493144 NCBI36
18591739
AGGACCCAGAACACCATCACCATCA G → A TGAACTGGGCACTGAAAGGACTTAC
-580
Ser → Asn
(D=46)
n=
G/G=
G/A=
A/A=
A=
200
91
7
2
0.055
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 16: CodingPDE
55342131 GRCh37
53493129 NCBI36
18741754
ATCACCATCAGTGAACTGGGCACTG A → G AAGGACTTACAATGTTCTTGCCATT
-585
Glu → Gly
(D=98)
n=
A/A=
A/G=
G/G=
G=
200
100
0
0
0.000
200
100
0
0
0.000
60
29
1
0
0.017
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
55338866 GRCh37
53489864 NCBI36
  
CAGAGCAAGACCCTGTCTCAAAAAA T → A ATATATATAAAAAATCAAACTTTGT
- 
 
n=
T/T=
T/A=
A/A=
A=
200
85
12
3
0.090
198
64
30
5
0.202
60
29
1
0
0.017
20
5
5
0
0.250
14
7
0
0
0.000
Set-I
Exon 18: CodingPDE
55336626 GRCh37
53487624 NCBI36
21412021
TTTACAGAATGGAATAAAAAGTTTA T → C GGCTGCCAGTGTGGCCTCCACCAAC
-674
Met → Thr
(D=81)
n=
T/T=
T/C=
C/C=
C=
200
100
0
0
0.000
200
100
0
0
0.000
60
27
3
0
0.050
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 
55335608 GRCh37
53486606 NCBI36
  
TGTTAATTCACAAATATTTATAGCT G → C CCGTTTCCTTTGCCCAAGATGACCT
- 
 
n=
G/G=
G/C=
C/C=
C=
192
0
0
96
1.000
196
0
0
98
1.000
60
0
0
30
1.000
20
0
0
10
1.000
14
0
0
7
1.000
Set-I
 PDE
55334469 GRCh37
53485467 NCBI36
  
CTAGGCAGTGGGAGTGAGATGCTGT C → A TCAAAAAACAAAATAAAATAAAATA
- 
 
n=
C/C=
C/A=
A/A=
A=
186
91
2
0
0.011
194
97
0
0
0.000
54
27
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 
55334442 GRCh37
53485440 NCBI36
  
CAAAAAACAAAATAAAATAAAATAA A → AATAAA AACAGCAGGAATGACATTTGACTTA
- 
 
n=
A/A=
A/AATAAA=
AATAAA/AATAAA=
AATAAA=
196
74
20
4
0.143
198
85
12
2
0.081
54
26
1
0
0.019
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
 PDEIA
55334295 GRCh37
53485293 NCBI36
  
AGTAAAAGCCTGCAGTATGAAATTA C → T GTAATAGCTCATCTTTGCAAATGCA
- 
 
n=
C/C=
C/T=
T/T=
T=
154
58
17
2
0.136
166
41
35
7
0.295
54
25
2
0
0.037
18
4
5
0
0.278
14
6
1
0
0.071
Set-I
 PDE
55334292 GRCh37
53485290 NCBI36
  
AAAAGCCTGCAGTATGAAATTACGT A → G ATAGCTCATCTTTGCAAATGCAAGA
- 
 
n=
A/A=
A/G=
G/G=
G=
154
77
0
0
0.000
166
82
1
0
0.006
54
27
0
0
0.000
18
9
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 21: CodingPDE
55329801 GRCh37
53480799 NCBI36
24522332
GGAAAACCAGAGGAATAGAGGTGGC G → A TCTACGCAAAGTTTGCACCTCCTGT
-778
Val → Ile
(D=29)
n=
G/G=
G/A=
A/A=
A=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 21: CodingPDE
55329775 GRCh37
53480773 NCBI36
24782358
TCTACGCAAAGTTTGCACCTCCTGT G → A CAGGAATCTTTTTTTCCACCCGGTG
-786
Val = Val
n=
G/G=
G/A=
A/A=
A=
200
98
2
0
0.010
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 22: CodingPDE
55328671 GRCh37
53479669 NCBI36
25622442
AGAATGAAATTCTTCTCGAGAAAAA G → T ACCAAGAGAAATAAGATTCTGAAGC
-814
Lys → Asn
(D=94)
n=
G/G=
G/T=
T/T=
T=
200
97
3
0
0.015
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 22: CodingPDE
55328560 GRCh37
53479558 NCBI36
26732553
AAGCTAAGAAAGAGCAGCGGCAGAA A → G AACTTTGTGGACCTGGCCTGCGAGT
-851
Lys = Lys
n=
A/A=
A/G=
G/G=
G=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 22: CodingPDE
55328558 GRCh37
53479556 NCBI36
26752555
GCTAAGAAAGAGCAGCGGCAGAAAA A → C CTTTGTGGACCTGGCCTGCGAGTGC
-852
Asn → Thr
(D=65)
n=
A/A=
A/C=
C/C=
C=
200
100
0
0
0.000
200
100
0
0
0.000
60
30
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
 PDEI
55328372 GRCh37
53479370 NCBI36
  
TGCACCCACGGCCAGTGAGGCCCAA C → T GTGCTAGAGAGGAGAAATGGCTGGA
- 
 
n=
C/C=
C/T=
T/T=
T=
200
100
0
0
0.000
200
100
0
0
0.000
60
29
1
0
0.017
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 23: CodingPDE
55322568 GRCh37
53473566 NCBI36
29092789
AGTGACTATTCCTTTGCTCAGTTCC G → A ATATCTGCAGAGGCTACTGCTGGTG
-930
Arg → Gln
(D=43)
n=
G/G=
G/A=
A/A=
A=
200
99
1
0
0.005
194
97
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 23: CodingPDEI
55322502 GRCh37
53473500 NCBI36
29752855
TACATAAGGATGTGCAAGTTCCTAC G → A ATACTTCTTTTACAAAAACTTTGCC
-952
Arg → Gln
(D=43)
n=
G/G=
G/A=
A/A=
A=
200
91
9
0
0.045
194
81
13
3
0.098
60
30
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
 PDE
55322412 GRCh37
53473410 NCBI36
  
TACTCTGCGCAGGTAATGTAATGTT G → A TTATTATTGTTATTTACTAAGTAGA
- 
 
n=
G/G=
G/A=
A/A=
A=
200
99
1
0
0.005
194
97
0
0
0.000
60
28
2
0
0.033
20
10
0
0
0.000
14
6
1
0
0.071
Set-I
 PDE
55322367 GRCh37
53473365 NCBI36
  
AGTAGAGCTCTTAAATGAATAAAAA T → A CTAGTTCTGAAAAGACAATTTATTT
- 
 
n=
T/T=
T/A=
A/A=
A=
158
64
14
1
0.101
158
46
31
2
0.222
58
29
0
0
0.000
14
3
4
0
0.286
12
5
1
0
0.083
Set-I
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 PDE
55319970 GRCh37
53470968 NCBI36
  
GAATAAAATACCATCATTTTGTTTT C → A TCCTTAAGGATGTGAGTGACAAACT
- 
 
n=
C/C=
C/A=
A/A=
A=
200
88
10
2
0.070
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
55319188 GRCh37
53470186 NCBI36
  
AGATTTTGACATAACTTCTGTTAAG T → C AATAAAATATACAAGGTGGAATGGC
- 
 
n=
T/T=
T/C=
C/C=
C=
200
100
0
0
0.000
200
100
0
0
0.000
60
28
2
0
0.033
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
55317591 GRCh37
53468589 NCBI36
  
CCATCAGAAAGTGATAAGGTATAAA G → T AATATAGTCCTTTCCCAACTCTGTC
- 
 
n=
G/G=
G/T=
T/T=
T=
200
95
5
0
0.025
200
72
27
1
0.145
60
30
0
0
0.000
20
8
2
0
0.100
14
6
1
0
0.071
Set-I
 PDEI
55315959 GRCh37
53466957 NCBI36
  
GGATCTTATTTTCATCCCTCCCCAT C → T TCTCCCCCTTGCAGATCCAGAAGCA
- 
 
n=
C/C=
C/T=
T/T=
T=
160
60
17
3
0.144
174
47
35
5
0.259
58
29
0
0
0.000
20
5
4
1
0.300
14
6
1
0
0.071
Set-I
Exon 28: CodingPDE
55315777 GRCh37
53466775 NCBI36
38193699
GCAGCATCCGCAAGAAGCGCTCGCC G → A CTTGATGCCATCGTGGCGGATGGCA
-1233
Pro = Pro
n=
G/G=
G/A=
A/A=
A=
160
77
2
1
0.025
166
81
1
1
0.018
54
27
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 28: CodingPDE
55315732 GRCh37
53466730 NCBI36
38643744
ATGGCACCGCGGAGTACAGGCGCAC C → A GGGGACAGCTGATCCCTTACCCCCA
-1248
Thr = Thr
n=
C/C=
C/A=
A/A=
A=
160
80
0
0
0.000
166
83
0
0
0.000
54
25
2
0
0.037
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 28: 3UTRPDE
55315709 GRCh37
53466707 NCBI36
3887 
ACCGGGGACAGCTGATCCCTTACCC C → T CAGGCTGGGATGCGGCCACAAAGCA
- 
 
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
166
80
3
0
0.018
54
27
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.