UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:CFTR
HGNC Symbol:CFTR
HGNC Description:cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)
HGNC ID:1884
Superfamily:ABC
Chromosome:Chr.7(+): 117120017-117308719 GRCh37
Location:7q31.2
OMIM:602421
OMIM Phenotype:cystic fibrosis
Accessions:NM_000492
Nucleotide RefSeq:NM_000492
Protein RefSeq:NP_000483
Entrez:1080
Ensembl:ENSG00000001626
Isoforms:1
Evidence:Substrate In Vitro Evidence: Anions (Cl-, NO3, SCN, H2SO4, etc.) Diphenylamine-2-carboxylic acid (DPC) - Blocks conductance Glibenclamide - Blocks conductance Tolbutamide - Blocks conductance Disulfonic stilbenes - Blocks conductance - Electrophysiology measurements with Xenopus oocytes, CHO cells and HEK293 cells. Dawson DC, et al. Physiol. Rev. 1999; 79: S47-75. 7,8-benzoflavones - Activator via direct interaction Pyrazolo derivatives - Activator via direct interaction - Fisher rat thyroid cells. Galietta LJ, et al. JBC. 2001 Jun 8; 276(23):19723-8. Tissue Distribution Evidence: Trachea > Testis, Prostate - TaqMan RT-PCR. Langmann T, et al. Clinical Chemistry. 2003; 49: 230-8.
Tissues:Trachea > Testis, Prostate
Type:protein-coding
Sets:V
PharmGKB ID:PA109
HPRD ID:03883
Substrates:Anions, Diphenylamine-2-carboxylic acid (DPC), Glibenclamide, Tolbutamide, Disulfonic stilbenes, 7,8-benzoflavones, Pyrazolo derivatives
Trivial Names:CF, MRP7, ABC35, ABCC7, CFTR/MRP, TNR-CFTR, dJ760C5.1
Transcripts:NM_000492.3 [Chr.7(+): 117120017-117308719 GRCh37]
ENST00000003084 [Chr.7(+): 117120017-117308715 GRCh37]
ENST00000426809 [Chr.7(+): 117120149-117307125 GRCh37]
ENST00000429014 [Chr.7(+): 117329767-117356025 GRCh37]
ENST00000446805 [Chr.7(+): 117119358-117171032 GRCh37]
ENST00000454343 [Chr.7(+): 117120017-117308719 GRCh37]
ENST00000468795 [Chr.7(+): 117251671-117267964 GRCh37]
ENST00000472848 [Chr.7(+): 117199692-117227803 GRCh37]
ENST00000546407 [Chr.7(+): 117105838-117144362 GRCh37]
ENST00000600166 [Chr.7(+): 117292897-117356002 GRCh37]
ENST00000608965 [Chr.7(+): 117350071-117355927 GRCh37]
ENST00000610149 [Chr.7(+): 117350186-117355881 GRCh37]

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for CFTR.

Variant Data

View all PMT variants for CFTR on UCSC Genome Browser
Showing SNP features for transcript: NM_000492  
CFTR Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:CFTR Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
PromoterPDE
117119861 GRCh37
116907097 NCBI36
-156-288
GCGAAGGAGGAGAGGAGGAAGGAGC G → C GGAGGGGTGCTGGCGGGGGTGCGTA
+ 
 
n=
G/G=
G/C=
C/C=
C=
132
64
2
0
0.015
134
67
0
0
0.000
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272
PromoterPDE
117119866 GRCh37
116907102 NCBI36
-151-283
GGAGGAGAGGAGGAAGGAGCGGGAG G → A GGTGCTGGCGGGGGTGCGTAGTGGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
66
0
0
0.000
134
67
0
0
0.000
136
67
1
0
0.007
132
66
0
0
0.000
PMT-272
PromoterPDE
117119875 GRCh37
116907111 NCBI36
-142-274
GAGGAAGGAGCGGGAGGGGTGCTGG C → A GGGGGTGCGTAGTGGGTGGAGAAAG
+ 
 
n=
C/C=
C/A=
A/A=
A=
132
65
1
0
0.008
134
66
1
0
0.007
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272
PromoterPDE
117119923 GRCh37
116907159 NCBI36
-94-226
AAGCCGCTAGAGCAAATTTGGGGCC G → T GACCAGGCAGCACTCGGCTTTTAAC
+ 
 
n=
G/G=
G/T=
T/T=
T=
132
63
3
0
0.023
134
67
0
0
0.000
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272
PromoterPDE
117119984 GRCh37
116907220 NCBI36
-33-165
AAGGCGGGGGAAAGAGCAAAAGGAA G → A GGGTGGTGTGCGGAGTAGGGGTGGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
66
0
0
0.000
134
67
0
0
0.000
136
68
0
0
0.000
132
65
1
0
0.008
PMT-272
 PDE1 pub
117306957 GRCh37
117094193 NCBI36
  
CCCAGATCTCACTAACAGCCATTTC C → T CTAGGTCATAGAAGAGAACAAAGTG
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
66
2
0
0.015
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 27: CodingPDE
117306991 GRCh37
117094227 NCBI36
44044272
TAGAAGAGAACAAAGTGCGGCAGTA C → T GATTCCATCCAGAAACTGCTGAACG
+1424
Tyr = Tyr
n=
C/C=
C/T=
T/T=
T=
136
68
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
136
67
1
0
0.007
PMT-272
Exon 27: CodingPDE4 pubsI
117307108 GRCh37
117094344 NCBI36
45214389
CAAGCAAGTGCAAGTCTAAGCCCCA G → A ATTGCTGCTCTGAAAGAGGAGACAG
+1463
Gln = Gln
n=
G/G=
G/A=
A/A=
A=
132
40
23
3
0.220
136
43
22
3
0.206
136
66
2
0
0.015
136
55
12
1
0.103
PMT-272
Exon 27: 3UTRPDE
117307243 GRCh37
117094479 NCBI36
4656 
ACAGTCACCTCATGGAATTGGAGCT C → T GTGGAACAGTTACCTCTGCCTCAGA
+ 
 
n=
C/C=
C/T=
T/T=
T=
134
66
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 27: 3UTRPDE
117307286 GRCh37
117094522 NCBI36
4699 
GCCTCAGAAAACAAGGATGAATTAA G → GC TTTTTTTTTAAAAAAGAAACATTTG
+ 
 
n=
G/G=
G/GC=
GC/GC=
GC=
134
67
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 27: 3UTR
117307295 GRCh37
117094531 NCBI36
4708 
AACAAGGATGAATTAAGTTTTTTTT T → - AAAAAAGAAACATTTGGTAAGGGGA
+ 
 
n=
T/T=
T/-=
-/-=
-=
136
3
21
44
0.801
136
34
31
3
0.272
136
33
26
9
0.324
136
28
30
10
0.368
PMT-272
Exon 27: 3UTRPDE
117307306 GRCh37
117094542 NCBI36
4719 
ATTAAGTTTTTTTTTAAAAAAGAAA C → T ATTTGGTAAGGGGAATTGAGGACAC
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 27: 3UTRPDE
117307460 GRCh37
117094696 NCBI36
4873 
CCTGAAAACCCTTGCCATGTGCTAG T → A AATTGGAAAGGCAGCTCTAAATGTC
+ 
 
n=
T/T=
T/A=
A/A=
A=
136
68
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
PMT-272
Exon 27: 3UTRPDEI
117307487 GRCh37
117094723 NCBI36
4900 
ATTGGAAAGGCAGCTCTAAATGTCA A → G TCAGCCTAGTTGATCAGCTTATTGT
+ 
 
n=
A/A=
A/G=
G/G=
G=
136
53
15
0
0.110
136
68
0
0
0.000
136
67
1
0
0.007
136
67
1
0
0.007
PMT-272
Exon 27: 3UTRPDE
117307846 GRCh37
117095082 NCBI36
5259 
GTCCAGGTCTACCAAAAATCTCAAT A → G TTTCAGATAATCACAATACATCCCT
+ 
 
n=
A/A=
A/G=
G/G=
G=
136
68
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 27: 3UTRPDE
117308194 GRCh37
117095430 NCBI36
5607 
ACTTCATGCTGTCTACACTAAGAGA GA → - ATGAGAGACACACTGAAGAAGCAC
+ 
 
n=
GA/GA=
GA/-=
-/-=
-=
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 27: 3UTRPDE1 pubA
117308205 GRCh37
117095441 NCBI36
5618 
TCTACACTAAGAGAGAATGAGAGAC A → C CACTGAAGAAGCACCAATCATGAAT
+ 
 
n=
A/A=
A/C=
C/C=
C=
134
64
3
0
0.022
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 27: 3UTRPDE
117308411 GRCh37
117095647 NCBI36
5824 
TATTGACTTTTTATGGCACTAGTAT T → C TCTATGAAATATTATGTTAAAACTG
+ 
 
n=
T/T=
T/C=
C/C=
C=
134
66
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 27: 3UTRPDEI
117308413 GRCh37
117095649 NCBI36
5826 
TTGACTTTTTATGGCACTAGTATTT C → T TATGAAATATTATGTTAAAACTGGG
+ 
 
n=
C/C=
C/T=
T/T=
T=
134
40
24
3
0.224
136
43
22
3
0.206
136
66
2
0
0.015
136
55
12
1
0.103
PMT-272
Exon 27: 3UTRPDE
117308456 GRCh37
117095692 NCBI36
5869 
AAACTGGGACAGGGGAGAACCTAGG G → A TGATATTAACCAGGGGCCATGAATC
+ 
 
n=
G/G=
G/A=
A/A=
A=
134
67
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
136
66
2
0
0.015
PMT-272
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
Exon 27: 3UTRPDE
117308554 GRCh37
117095790 NCBI36
5967 
ACAGCTGTATGATTCCCAGCCAGCA C → G AGCCTCTTAGATGCAGTTCTGAAGA
+ 
 
n=
C/C=
C/G=
G/G=
G=
134
66
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.