UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:SBAT1,NTCP
HGNC Symbol:SLC10A1
HGNC Description:solute carrier family 10 (sodium/bile acid cotransporter), member 1
HGNC ID:10905
Superfamily:SLC
Chromosome:Chr.14(-): 70242552-70264006 GRCh37
Location:14q24.1
OMIM:182396
OMIM Phenotype:None
Accessions:L21893
Nucleotide RefSeq:NM_003049
Protein RefSeq:NP_003040
Entrez:6554
Ensembl:ENSG00000100652
Isoforms:1
Evidence:Substrate In Vitro Evidence: taurocholate 2 Xenopus laevis oocytes taurochenodeoxycholate 2 Xenopus laevis oocytes glycocholate (rat) 10 CHO cells estrone 3-sulfate (rat) 10 CHO cells Substrate In Vivo Evidence: decreased mRNA expression in liver biopsies from patients with cholestatic liver disease 28 RT_PCR Tissue Distribution Evidence: liver Genomics 69, 203-213 (2000) Northern
Tissues:liver
Type:protein-coding
Sets:II,IV
PharmGKB ID:PA317
HPRD ID:01672
Substrates:Taurocholate, taurochenodeoxycholate, glycocholate, estrone 3-sulfate
Trivial Names:NTCP
Transcripts:NM_003049.3 [Chr.14(-): 70242552-70264006 GRCh37]
ENST00000216540 [Chr.14(-): 70242134-70264006 GRCh37]
Annotation History:View Events (2)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC10A1.

Variant Data

View all PMT variants for SLC10A1 on UCSC Genome Browser
Showing SNP features for transcript: NM_003049  
SLC10A1 RESEQUENCING  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC10A1 RESEQUENCING
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
Exon 1: 5UTRPDE
70263911 GRCh37
69333664 NCBI36
96-39
GAACTGCACAAGAAACGGAGTCAGC C → T GGAGAACAAGGAGTGGTCTTCCACT
- 
 
n=
C/C=
C/T=
T/T=
T=
128
56
7
1
0.070
130
65
0
0
0.000
130
65
0
0
0.000
126
62
1
0
0.008
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.