UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:NRAMP1
HGNC Symbol:SLC11A1
HGNC Description:solute carrier family 11 (proton-coupled divalent metal ion transporter), member 1
HGNC ID:10907
Superfamily:SLC
Chromosome:Chr.2(+): 219246752-219261617 GRCh37
Location:2q35
OMIM:600266
OMIM Phenotype:None
Accessions:X82015
Nucleotide RefSeq:NM_000578
Protein RefSeq:NP_000569
Entrez:6556
Ensembl:ENSG00000018280
Isoforms:4
Evidence:Substrate In Vitro Evidence: Little functional data on the human SLC11 family transporters are yet available. However, these genes bear a high degree of homology to the rat transporter DCT1, which transports divalent metal ions by a proton-symport mechanism. Fe2+, Zn2+, Mn2+, Co2+, Cd2+, Cu2+, Ni2+ and Pb2+ were shown to be substrates of DCT1 by the two-electrode voltage clamp technique in rDCT1-injected X. laevis oocytes (Gunshin H, Mackenzie B, Berger UV, Gunshin Y, Romero MF, Boron WF, Nussberger S, Gollan JL, Hediger MA. Cloning and characterization of a mammalian proton-coupled metal-ion transporter. Nature 388(6641):482-8, 1997). A recent study showed the human NRAMP1 to be a transporter of Zn2+ and Mn2+ by electrophysiological measurements in NRAMP1-injected X. laevis oocytes (Goswami T, Bhattacharjee A, Babal P, Searle S, Moore E, Li M, Blackwell JM. Natural-resistance-associated macrophage protein 1 is an H+/bivalent cation antiporter. Biochem J 354(Pt 3):511-9, 2001). Substrate In Vivo Evidence: Human SLC11 family members were cloned by homology to the rodent homologs, whose molecular function was relatively unknown, but which were known to function physiologically as mediators of natural resistance to infection (thus, Natural resistance-associated macrophage proteins). Association of polymorphisms in the human NRAMP1 gene with a variety of infectious diseases (tuberculosis, leprosy, HIV, and meningitis), as well as autoimmune diseases (rheumatoid arthritis, type 1 diabetes, Crohn's disease, and Kawasaki disease) have been described (reviewed in: Mackenzie B, Hediger MA. SLC11 family of H(+)-coupled metal-ion transporters NRAMP1 and DMT1. Pflugers Arch, Oct7, 2003 [Epub ahead of print]). The effect of SLC11 transporters on resistance to infectious disease is assumed to be related to extrusion of divalent metal ions by host macrophages from the phagolysosome, thereby reducing availability of these ions that may be required as cofactors for bacterial enzymes or for bacterial growth. Tissue Distribution Evidence: Northern blot analysis of multiple tissues showed restricted expression of NRAMP1, with highest expression in peripheral blood leukocytes (macrophages, neutrophils), and lower expression in lung and spleen (Cellier M, Govoni G, Vidal S, Kwan T, Groulx N, Liu J, Sanchez F, Skamene E, Schurr E, Gros P. Human natural resistance-associated macrophage protein: cDNA cloning, chromosomal mapping, genomic organization, and tissue-specific expression. J Exp Med 180(5):1741-52, 1994).
Tissues:Peripheral blood leukocytes (macrophages, neutrophils) (high);lung, spleen (low)
Type:protein-coding
Sets:I,V
PharmGKB ID:PA319
HPRD ID:02601
Substrates:Zn2+, Mn2+
Trivial Names:LSH, NRAMP, NRAMP1
Transcripts:NM_000578.3 [Chr.2(+): 219246752-219261617 GRCh37]
XM_005246792.1 [Chr.2(+): 219246769-219261617 GRCh37]
XM_005246793.1 [Chr.2(+): 219246769-219261617 GRCh37]
XM_005246794.1 [Chr.2(+): 219246996-219261617 GRCh37]
ENST00000233202 [Chr.2(+): 219246752-219261617 GRCh37]
ENST00000354352 [Chr.2(+): 219246971-219260046 GRCh37]
ENST00000460592 [Chr.2(+): 219249878-219250297 GRCh37]
ENST00000465984 [Chr.2(+): 219246911-219260749 GRCh37]
ENST00000468221 [Chr.2(+): 219246752-219260750 GRCh37]
ENST00000468721 [Chr.2(+): 219257563-219258909 GRCh37]
ENST00000469449 [Chr.2(+): 219248410-219253108 GRCh37]
ENST00000469799 [Chr.2(+): 219247002-219251835 GRCh37]
ENST00000471875 [Chr.2(+): 219247002-219251495 GRCh37]
ENST00000473367 [Chr.2(+): 219246892-219251390 GRCh37]
ENST00000475225 [Chr.2(+): 219247025-219253108 GRCh37]
ENST00000481524 [Chr.2(+): 219246996-219252307 GRCh37]
ENST00000483487 [Chr.2(+): 219248890-219251536 GRCh37]
ENST00000486451 [Chr.2(+): 219246926-219251884 GRCh37]
ENST00000490536 [Chr.2(+): 219257313-219259358 GRCh37]
ENST00000490872 [Chr.2(+): 219254688-219256494 GRCh37]
ENST00000492413 [Chr.2(+): 219247010-219251857 GRCh37]
ENST00000494322 [Chr.2(+): 219246996-219257358 GRCh37]
ENST00000539932 [Chr.2(+): 219247032-219260014 GRCh37]
Annotation History:View Events (26)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC11A1.

Variant Data

View all PMT variants for SLC11A1 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC11A1 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC11A1 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 PDE
219247656 GRCh37
218955900 NCBI36
  
TGGGCCACCAGAAAGAGGCAGGACA C → T TCACCATGCTTCATGGGCCCCCACA
+ 
 
n=
C/C=
C/T=
T/T=
T=
188
84
10
0
0.053
186
93
0
0
0.000
56
28
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 2: CodingPDE
219247711 GRCh37
218955955 NCBI36
37636
ACAAGGGTCCCCAAAGGCTAAGCGG G → A TCCAGCTATGGTTCCATCTCCAGCC
+12
Gly = Gly
n=
G/G=
G/A=
A/A=
A=
188
94
0
0
0.000
192
95
1
0
0.005
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 2: Coding
219247747 GRCh37
218955991 NCBI36
41272
GTTCCATCTCCAGCCCGACCAGCCC G → - ACCAGCCCAGGGCCACAGCAAGCAC
+24
Pro → DEL
n=
G/G=
G/-=
-/-=
-=
188
93
1
0
0.005
192
96
0
0
0.000
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 2: CodingPDE
219247748 GRCh37
218955992 NCBI36
41373
TTCCATCTCCAGCCCGACCAGCCCG A → - CCAGCCCAGGGCCACAGCAAGCACC
+25
Thr → DEL
n=
A/A=
A/-=
-/-=
-=
188
93
1
0
0.005
192
96
0
0
0.000
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 2: CodingPDE
219247749 GRCh37
218955993 NCBI36
41474
TCCATCTCCAGCCCGACCAGCCCGA C → - CAGCCCAGGGCCACAGCAAGCACCT
+25
Thr → DEL
n=
C/C=
C/-=
-/-=
-=
188
93
1
0
0.005
192
96
0
0
0.000
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 2: CodingPDE
219247750 GRCh37
218955994 NCBI36
41575
CCATCTCCAGCCCGACCAGCCCGAC C → - AGCCCAGGGCCACAGCAAGCACCTC
+25
Thr → DEL
n=
C/C=
C/-=
-/-=
-=
188
93
1
0
0.005
192
96
0
0
0.000
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 2: CodingPDE
219247751 GRCh37
218955995 NCBI36
41676
CATCTCCAGCCCGACCAGCCCGACC A → - GCCCAGGGCCACAGCAAGCACCTCC
+26
Ser → DEL
n=
A/A=
A/-=
-/-=
-=
188
93
1
0
0.005
192
96
0
0
0.000
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 2: CodingPDE
219247752 GRCh37
218955996 NCBI36
41777
ATCTCCAGCCCGACCAGCCCGACCA G → - CCCAGGGCCACAGCAAGCACCTCCC
+26
Ser → DEL
n=
G/G=
G/-=
-/-=
-=
188
93
1
0
0.005
192
96
0
0
0.000
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 2: CodingPDE
219247753 GRCh37
218955997 NCBI36
41878
TCTCCAGCCCGACCAGCCCGACCAG C → - CCAGGGCCACAGCAAGCACCTCCCA
+26
Ser → DEL
n=
C/C=
C/-=
-/-=
-=
188
93
1
0
0.005
192
96
0
0
0.000
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 2: CodingPDE
219247754 GRCh37
218955998 NCBI36
41979
CTCCAGCCCGACCAGCCCGACCAGC C → - CAGGGCCACAGCAAGCACCTCCCAG
+27
Pro → DEL
n=
C/C=
C/-=
-/-=
-=
188
93
1
0
0.005
192
96
0
0
0.000
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 2: CodingPDE
219247755 GRCh37
218955999 NCBI36
42080
TCCAGCCCGACCAGCCCGACCAGCC C → - AGGGCCACAGCAAGCACCTCCCAGA
+27
Pro → DEL
n=
C/C=
C/-=
-/-=
-=
188
93
1
0
0.005
192
96
0
0
0.000
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 2: CodingPDEIA
219247790 GRCh37
218956034 NCBI36
455115
GCAAGCACCTCCCAGAGAGACCTAC C → T TGAGTGAGAAGATCCCCATCCCAGA
+39
Leu = Leu
n=
C/C=
C/T=
T/T=
T=
188
65
27
2
0.165
192
96
0
0
0.000
58
28
1
0
0.017
20
6
4
0
0.200
14
5
2
0
0.143
Set-I
 PDE
219248955 GRCh37
218957199 NCBI36
  
GGACCCCCTCACTCTACTCCTCCCA C → T CCCCCAACAGGGCACCTTCAGCCTG
+ 
 
n=
C/C=
C/T=
T/T=
T=
200
86
13
1
0.075
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 3: CodingPDE6 pubsIA
219249013 GRCh37
218957257 NCBI36
538198
TATGGGCCTTCACGGGGCCTGGCTT C → T CTCATGAGCATTGCTTTCCTGGACC
+66
Phe = Phe
n=
C/C=
C/T=
T/T=
T=
200
95
5
0
0.025
200
92
7
1
0.045
60
29
1
0
0.017
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
219249099 GRCh37
218957343 NCBI36
  
GTGGCGGGATTCAAAGTAACTAAGT C → T GGGACCTGAGTGGGGACACTTTCGA
+ 
 
n=
C/C=
C/T=
T/T=
T=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
219249828 GRCh37
218958072 NCBI36
  
ACCACGAGCTCAGGGGCTTTCTGAG G → A CTGGCCTCTCTGGCTGAAGGCCTCT
+ 
 
n=
G/G=
G/A=
A/A=
A=
192
96
0
0
0.000
196
98
0
0
0.000
56
27
1
0
0.018
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE8 pubs
219250003 GRCh37
218958247 NCBI36
  
TACTACCCTAAGGTGAGCTTGGGGG G → C CCTGGACAGGGAGAACCACTGGCCC
+ 
 
n=
G/G=
G/C=
C/C=
C=
196
69
27
2
0.158
150
32
36
7
0.333
60
26
4
0
0.067
20
7
1
2
0.250
14
4
3
0
0.214
Set-I
 PDE
219251865 GRCh37
218960109 NCBI36
  
CCCCTGGACCAGGCTGGGCTGACCC G → A GGCCACTCTGGTTTCAGAATCCCAC
+ 
 
n=
G/G=
G/A=
A/A=
A=
200
100
0
0
0.000
200
100
0
0
0.000
60
25
5
0
0.083
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
219251879 GRCh37
218960123 NCBI36
  
TGGGCTGACCCGGGCCACTCTGGTT T → G CAGAATCCCACTCTGGGGTGGCGTC
+ 
 
n=
T/T=
T/G=
G/G=
G=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
219251966 GRCh37
218960210 NCBI36
  
CTCGATAACTACGGTGGGTGCACAC C → T CCACCTCATAGGGGAGTGGTGGTGG
+ 
 
n=
C/C=
C/T=
T/T=
T=
200
100
0
0
0.000
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
6
1
0
0.071
Set-I
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 PDE
219252257 GRCh37
218960501 NCBI36
  
TTGATGTCACAGATTTTTTTCGTTG G → A TTTGTTTAGTTTGTTTGTTCTGCTC
+ 
 
n=
G/G=
G/A=
A/A=
A=
174
82
5
0
0.029
180
90
0
0
0.000
58
29
0
0
0.000
20
10
0
0
0.000
10
5
0
0
0.000
Set-I
 PDEI
219252377 GRCh37
218960621 NCBI36
  
TGAGGTAGGAAGCCAGTGCTGCAAC C → T CCACTGTGGACCTCCCAAGATCATT
+ 
 
n=
C/C=
C/T=
T/T=
T=
186
64
23
6
0.188
188
47
40
7
0.287
58
26
3
0
0.052
20
8
1
1
0.150
10
3
1
1
0.300
Set-I
 PDE
219252413 GRCh37
218960657 NCBI36
  
CCTCCCAAGATCATTCCTCTCCCTT C → T CCTCTGGCCGCGGGCTGCGGGGGGC
+ 
 
n=
C/C=
C/T=
T/T=
T=
186
93
0
0
0.000
188
93
1
0
0.005
58
29
0
0
0.000
20
10
0
0
0.000
10
5
0
0
0.000
Set-I
 PDE
219252431 GRCh37
218960675 NCBI36
  
CTCCCTTCCCTCTGGCCGCGGGCTG C → A GGGGGGCTGGGGTGGGATGGAGGCT
+ 
 
n=
C/C=
C/A=
A/A=
A=
186
90
2
1
0.022
188
94
0
0
0.000
58
29
0
0
0.000
20
10
0
0
0.000
10
5
0
0
0.000
Set-I
Exon 8: CodingPDE3 pubs
219252630 GRCh37
218960874 NCBI36
1087747
TGCTGCAGGCGGTGGGCATTGTTGG C → T GCCATCATCATGCCCCACAACATCT
+249
Gly = Gly
n=
C/C=
C/T=
T/T=
T=
174
53
29
5
0.224
176
82
6
0
0.034
48
22
2
0
0.042
20
7
3
0
0.150
10
5
0
0
0.000
Set-I
 PDE
219257688 GRCh37
218965932 NCBI36
  
GTCCTGTCTACTCCTCACCAAGGAG T → C TCACCCCCACCCCAGGGCTTCCTGA
+ 
 
n=
T/T=
T/C=
C/C=
C=
200
91
6
3
0.060
200
92
1
7
0.075
60
27
0
3
0.100
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
219257697 GRCh37
218965941 NCBI36
  
ACTCCTCACCAAGGAGTTCACCCCC A → C CCCCAGGGCTTCCTGAGGCTGCGGT
+ 
 
n=
A/A=
A/C=
C/C=
C=
200
100
0
0
0.000
200
100
0
0
0.000
60
28
2
0
0.033
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 13: CodingPDE
219258853 GRCh37
218967097 NCBI36
16651325
TGCTGCTCTCCCCAGCTCCCGTTCG C → CGTTCGC CGTGCTGCCCATCCTCACGTTCACC
+442
Ala → INS
n=
C/C=
C/CGTTCGC=
CGTTCGC/CGTTCGC=
CGTTCGC=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 13: CodingPDE
219258856 GRCh37
218967100 NCBI36
16681328
TGCTCTCCCCAGCTCCCGTTCGCCG T → C GCTGCCCATCCTCACGTTCACCAGC
+443
Val → Ala
(D=64)
n=
T/T=
T/C=
C/C=
C=
200
100
0
0
0.000
200
99
1
0
0.005
60
29
1
0
0.017
20
10
0
0
0.000
14
7
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.