UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:DMT1
HGNC Symbol:SLC11A2
HGNC Description:solute carrier family 11 (proton-coupled divalent metal ion transporter), member 2
HGNC ID:10908
Superfamily:SLC
Chromosome:Chr.12(-): 51373566-51422118 GRCh37
Location:12q13
OMIM:600523
OMIM Phenotype:None
Accessions:AB004857
Nucleotide RefSeq:NM_000617
Protein RefSeq:NP_000608
Entrez:4891
Ensembl:ENSG00000110911
Isoforms:14
Evidence:Substrate In Vitro Evidence: Little functional data on the human SLC11 family transporters are yet available. However, these genes bear a high degree of homology to the rat SLC11A2 ortholog (rDCT1), which transports divalent metal ions by a proton-symport mechanism. Fe2+, Zn2+, Mn2+, Co2+, Cd2+, Cu2+, Ni2+ and Pb2+ were shown to be substrates of DCT1 by the two-electrode voltage clamp technique in rDCT1-injected X. laevis oocytes (Gunshin H, Mackenzie B, Berger UV, Gunshin Y, Romero MF, Boron WF, Nussberger S, Gollan JL, Hediger MA. Cloning and characterization of a mammalian proton-coupled metal-ion transporter. Nature 388(6641):482-8, 1997). Substrate In Vivo Evidence: A missense mutation (G185R) in the Nramp2 gene was found to be the causative mutation in mice with hypochromic microcytic anemia (mk/mk mice). The anemia results from severe defects in intestinal iron absorption and erythroid iron utilization (Fleming, MD, Trenor CC, Su MA, Foernzler D, Beier DR, Dietrich WF, Andrews NC. Microcytic anaemia mice have a mutation in Nramp2, a candidate iron transporter gene. Nature Genetics 16(4):383-386, 1997). The Belgrade rat (b rat) is marked by an autosomal recessively inherited, microcytic, hypochromic anemia associated with abnormal reticulocyte iron uptake and gastrointestinal iron absorption. Interestingly, the genetic defect in the b rat was found to be the same missense mutation (G185R) in Nramp2 (rDCT1) identified as the cause of the microcytic anemia in mk/mk mice (Fleming MD, Romano MA, Su MA, Garrick LM, Garrick MD, Andrews NC. Nramp2 is mutated in the anemic Belgrade (b) rat: evidence of a role for Nramp2 in endosomal iron transport. Proc Natl Acad Sci USA 95(3):1148-53, 1998). Tissue Distribution Evidence: In contrast to NRAMP1, which has a restricted tissue distribution, NRAMP2 mRNA was detected by Northern blot in all tissues examined, including intestine, erythroid cells, kidney, lung, brain, testis (Sertoli cells), and thymus (Vidal S, Belouchi AM, Cellier M, Beatty B, Gros P. Cloning and characterization of a second human NRAMP gene on chromosome 12q13. Mamm Genome 6(4):224-30, 1995).
Tissues:Intestine, erythroid cells, kidney, lung, brain, testis (Sertoli cells), thymus
Type:protein-coding
Sets:I,V
PharmGKB ID:PA259
HPRD ID:02750
Substrates:Rat: Fe2+, Zn2+, Mn2+, Co2+, Cd2+, Cu2+, Ni2+, Pb2+
Trivial Names:DCT1, DMT1, NRAMP2
Transcripts:NM_000617.2 [Chr.12(-): 51379775-51420199 GRCh37]
NM_001174127.1 [Chr.12(-): 51373566-51420199 GRCh37]
NM_001174126.1 [Chr.12(-): 51373566-51420199 GRCh37]
NM_001174125.1 [Chr.12(-): 51379775-51422058 GRCh37]
NM_001174128.1 [Chr.12(-): 51379775-51420199 GRCh37]
NM_001174129.1 [Chr.12(-): 51379775-51419924 GRCh37]
NM_001174130.1 [Chr.12(-): 51379775-51403053 GRCh37]
XM_005268911.1 [Chr.12(-): 51374792-51422118 GRCh37]
XM_005268913.1 [Chr.12(-): 51374792-51420183 GRCh37]
XM_005268914.1 [Chr.12(-): 51374792-51420174 GRCh37]
XM_005268917.1 [Chr.12(-): 51374792-51420172 GRCh37]
XM_005268916.1 [Chr.12(-): 51374792-51420148 GRCh37]
XM_005268912.1 [Chr.12(-): 51374792-51403102 GRCh37]
XM_005268915.1 [Chr.12(-): 51379775-51420183 GRCh37]
ENST00000262051 [Chr.12(-): 51373318-51420142 GRCh37]
ENST00000262052 [Chr.12(-): 51379775-51420167 GRCh37]
ENST00000394904 [Chr.12(-): 51379775-51422058 GRCh37]
ENST00000541174 [Chr.12(-): 51381729-51419924 GRCh37]
ENST00000545993 [Chr.12(-): 51381956-51403032 GRCh37]
ENST00000546488 [Chr.12(-): 51390724-51420167 GRCh37]
ENST00000546636 [Chr.12(-): 51373603-51420151 GRCh37]
ENST00000546743 [Chr.12(-): 51382103-51420183 GRCh37]
ENST00000547198 [Chr.12(-): 51374792-51420121 GRCh37]
ENST00000547510 [Chr.12(-): 51390654-51420176 GRCh37]
ENST00000547579 [Chr.12(-): 51390744-51420174 GRCh37]
ENST00000547688 [Chr.12(-): 51381722-51422349 GRCh37]
ENST00000547732 [Chr.12(-): 51394101-51420146 GRCh37]
ENST00000548150 [Chr.12(-): 51404503-51418626 GRCh37]
ENST00000548193 [Chr.12(-): 51394185-51420167 GRCh37]
ENST00000548554 [Chr.12(-): 51384367-51385450 GRCh37]
ENST00000549110 [Chr.12(-): 51394133-51399631 GRCh37]
ENST00000549193 [Chr.12(-): 51399105-51402951 GRCh37]
ENST00000549625 [Chr.12(-): 51399102-51420167 GRCh37]
ENST00000550061 [Chr.12(-): 51389467-51393348 GRCh37]
ENST00000550329 [Chr.12(-): 51401928-51420162 GRCh37]
ENST00000550714 [Chr.12(-): 51393151-51420167 GRCh37]
ENST00000550782 [Chr.12(-): 51379776-51388875 GRCh37]
ENST00000550995 [Chr.12(-): 51399187-51420148 GRCh37]
ENST00000551215 [Chr.12(-): 51373184-51385992 GRCh37]
ENST00000551231 [Chr.12(-): 51385382-51386927 GRCh37]
Annotation History:View Events (62)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC11A2.

Variant Data

View all PMT variants for SLC11A2 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC11A2 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC11A2 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 PDE
51404472 GRCh37
49690739 NCBI36
  
TGAACAGAAGATGTCAGATGGTAAT T → G TACCACTTTGTGTTATTGTCTAATT
- 
 
n=
T/T=
T/G=
G/G=
G=
200
100
0
0
0.000
198
97
2
0
0.010
58
29
0
0
0.000
20
10
0
0
0.000
14
6
1
0
0.071
Set-I
 PDE
51404468 GRCh37
49690735 NCBI36
  
CAGAAGATGTCAGATGGTAATTTAC C → T ACTTTGTGTTATTGTCTAATTTTAT
- 
 
n=
C/C=
C/T=
T/T=
T=
200
100
0
0
0.000
198
98
1
0
0.005
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
51404467 GRCh37
49690734 NCBI36
  
AGAAGATGTCAGATGGTAATTTACC A → G CTTTGTGTTATTGTCTAATTTTATT
- 
 
n=
A/A=
A/G=
G/G=
G=
200
12
41
47
0.675
198
35
48
16
0.404
58
0
4
25
0.931
20
1
4
5
0.700
14
1
3
3
0.643
Set-I
 PDE
51404438 GRCh37
49690705 NCBI36
  
TGTGTTATTGTCTAATTTTATTTGT A → C ATTAGGTTTATGTTGGTAACAGAAA
- 
 
n=
A/A=
A/C=
C/C=
C=
162
68
13
0
0.080
192
96
0
0
0.000
56
28
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 4: CodingPDE
51399219 GRCh37
49685486 NCBI36
329184
TAATCTCTTTTCCTCTCTTGTACAG T → C ACTCTTGTTTTAGCTTTCGTAAACT
-62
Tyr → His
(D=83)
n=
T/T=
T/C=
C/C=
C=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 4: CodingPDE
51399148 GRCh37
49685415 NCBI36
400255
GTTTTCTTATGAGCATTGCCTACCT G → T GATCCAGGAAATATTGAATCCGATT
-85
Leu = Leu
n=
G/G=
G/T=
T/T=
T=
200
100
0
0
0.000
200
100
0
0
0.000
60
29
1
0
0.017
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
51399058 GRCh37
49685325 NCBI36
  
AGTCCTACCCCTGTCCTTTTAAGCA C → T ATAATACCCTCTCACATCCTTTTCT
- 
 
n=
C/C=
C/T=
T/T=
T=
200
99
0
1
0.010
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
51393233 GRCh37
49679500 NCBI36
  
GTTTTTCAATGTTTCCTTTCTTTCC G → A TCTCTCTGACTTCCATATCTCATCT
- 
 
n=
G/G=
G/A=
A/A=
A=
190
95
0
0
0.000
188
93
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
51393116 GRCh37
49679383 NCBI36
  
CTTGGACAAATATGGTAAGGAGAGC A → G GGAATGGGAGGGTCAAAGGAGCTGC
- 
 
n=
A/A=
A/G=
G/G=
G=
196
0
20
78
0.898
198
0
28
71
0.859
60
4
11
15
0.683
20
1
4
5
0.700
14
0
3
4
0.786
Set-I
 PDE
51393070 GRCh37
49679337 NCBI36
  
GCTGCTCTCTGTCATGTGGCAGATG G → A GGAAGTCTACCTTCTCTGAGCTCAC
- 
 
n=
G/G=
G/A=
A/A=
A=
196
98
0
0
0.000
198
99
0
0
0.000
60
29
1
0
0.017
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
51393061 GRCh37
49679328 NCBI36
  
TGTCATGTGGCAGATGGGGAAGTCT A → G CCTTCTCTGAGCTCACTGCTGCCTT
- 
 
n=
A/A=
A/G=
G/G=
G=
196
98
0
0
0.000
198
99
0
0
0.000
60
29
1
0
0.017
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
51390794 GRCh37
49677061 NCBI36
  
TGGTACTATGTTACTCCCGTTTCAC G → A TTCCTGTAAAGGCTAATCATTGTTA
- 
 
n=
G/G=
G/A=
A/A=
A=
200
100
0
0
0.000
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
51389615 GRCh37
49675882 NCBI36
  
AACTCCTGAAATGTCACAAGGAAAC T → G TGTTCTAACTGGTCAAAAAGTGACT
- 
 
n=
T/T=
T/G=
G/G=
G=
200
96
4
0
0.020
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 10: CodingPDE
51389533 GRCh37
49675800 NCBI36
1014869
AACCGGAACAATAAGCAGGAAGTTC G → A AGAAGCCAATAAGTACTTTTTCATT
-290
Arg → Gln
(D=43)
n=
G/G=
G/A=
A/A=
A=
200
100
0
0
0.000
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
6
1
0
0.071
Set-I
Exon 10: CodingPDE
51389509 GRCh37
49675776 NCBI36
1038893
CGAGAAGCCAATAAGTACTTTTTCA T → C TGAATCCTGCATTGCACTCTTTGTT
-298
Ile → Thr
(D=89)
n=
T/T=
T/C=
C/C=
C=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
 PDE
51388438 GRCh37
49674705 NCBI36
  
GGTCCTTGCTTCTGAAACAAAAGTT G → T CTGTTGAATTGCTTTGGGTTCTAGG
- 
 
n=
G/G=
G/T=
T/T=
T=
200
100
0
0
0.000
200
98
2
0
0.010
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDEI
51386184 GRCh37
49672451 NCBI36
  
ATTCTTCTGAGGTCTCTCCTGAACC T → G CCCCAAAACTTTTTTTTGTTTCCTG
- 
 
n=
T/T=
T/G=
G/G=
G=
194
81
16
0
0.082
200
100
0
0
0.000
58
29
0
0
0.000
12
6
0
0
0.000
6
3
0
0
0.000
Set-I
 PDE
51386152 GRCh37
49672419 NCBI36
  
AACTTTTTTTTGTTTCCTGTTGCAG A → G CAGTCATCTGCTCCTATGTTTTCTT
- 
 
n=
A/A=
A/G=
G/G=
G=
194
93
4
0
0.021
200
100
0
0
0.000
58
29
0
0
0.000
12
6
0
0
0.000
6
3
0
0
0.000
Set-I
Exon 13: CodingPDE1 pubI
51386066 GRCh37
49672333 NCBI36
13991254
CCCGAGTGGTTCTGACTCGCTCTAT T → C GCCATCATCCCCACTCTGCTTGTTG
-418
Ile = Ile
n=
T/T=
T/C=
C/C=
C=
194
78
18
1
0.103
200
73
22
5
0.160
58
23
6
0
0.103
12
4
2
0
0.167
6
2
1
0
0.167
Set-I
 PDE
51384749 GRCh37
49671016 NCBI36
  
AGTTGGATTATTCCATCAGTGACTG T → A GCTGATTTCTTTTACAGAGGCTGGC
- 
 
n=
T/T=
T/A=
A/A=
A=
200
93
7
0
0.035
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 15: CodingPDE
51384655 GRCh37
49670922 NCBI36
16431498
TATGTACTTTGTAGTGGTTTATGTC C → T GGGACCTAGGGCATGTGGCATTATA
-500
Arg → Trp
(D=101)
n=
C/C=
C/T=
T/T=
T=
200
98
2
0
0.010
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
51384554 GRCh37
49670821 NCBI36
  
TGGTAAGTCTAGCCTGGAAGAGCAG G → A GGCATAGGTATCAGGGATGGTTGAG
- 
 
n=
G/G=
G/A=
A/A=
A=
200
92
8
0
0.040
198
99
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDEI
51382232 GRCh37
49668499 NCBI36
  
AAAGAGCCTGGTGAGTGATGACCAT G → A TTTTGTCTTTCAGGGTTGGCAATGT
- 
 
n=
G/G=
G/A=
A/A=
A=
200
68
31
1
0.165
200
91
8
1
0.050
60
30
0
0
0.000
20
9
1
0
0.050
14
6
1
0
0.071
Set-I
Exon 16: 3UTRPDE
51381858 GRCh37
49668125 NCBI36
2081 
GCCCTTGGGCAACTACTTAAGAATT T → C AGTGTTGGAATGATAGCAGCAAATG
+ 
 
n=
T/T=
T/C=
C/C=
C=
128
64
0
0
0.000
136
68
0
0
0.000
130
64
1
0
0.008
132
66
0
0
0.000
n/a
0.000
PMT-272
Exon 16: 3UTRPDE
51381832 GRCh37
49668099 NCBI36
2107 
GTCTCTCCGAAGGATAAACTGAGCT G → A GCCCTTGGGCAACTACTTAAGAATT
+ 
 
n=
G/G=
G/A=
A/A=
A=
128
64
0
0
0.000
136
68
0
0
0.000
130
64
1
0
0.008
132
66
0
0
0.000
n/a
0.000
PMT-272
Exon 16: 3UTRPDE1 pubI
51381750 GRCh37
49668017 NCBI36
2189 
TGTAGTTTGTATAATAAAAAATGTA T → C TGCATTTTCCAATTTTTTTTTAACA
+ 
 
n=
T/T=
T/C=
C/C=
C=
128
49
15
0
0.117
136
40
24
4
0.235
130
54
10
1
0.092
132
55
11
0
0.083
n/a
0.000
PMT-272
Exon 16: 3UTRPDEIA
51381718 GRCh37
49667985 NCBI36
2221 
CATTTTGATAAATAAAACTTGCATA C → T TCATTCTGTAGTTTGTATAATAAAA
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
50
14
1
0.123
136
43
25
0
0.184
130
13
36
16
0.523
132
45
19
2
0.174
n/a
0.000
PMT-272
Exon 16: 3UTRPDE
51381622 GRCh37
49667889 NCBI36
2317 
ATATGGATGAAGCTATTCTAGTTGA T → C AATTTGGTATAATTAAAATAACTGA
+ 
 
n=
T/T=
T/C=
C/C=
C=
130
64
1
0
0.008
136
68
0
0
0.000
130
65
0
0
0.000
132
66
0
0
0.000
n/a
0.000
PMT-272
Exon 16: 3UTRPDE
51381319 GRCh37
49667586 NCBI36
2620 
AAAGAAAGTTAAGGTTTTACAACCA C → T ATGTGCTCAAGAGTAAATATCATCA
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
63
2
0
0.015
136
68
0
0
0.000
130
65
0
0
0.000
132
66
0
0
0.000
n/a
0.000
PMT-272
Exon 16: 3UTRPDE
51381236 GRCh37
49667503 NCBI36
2703 
GTCTTTTCTCCCCACCCTCAACATT T → G CACGAGAACATCAGTTCATAAATAC
+ 
 
n=
T/T=
T/G=
G/G=
G=
130
63
2
0
0.015
136
68
0
0
0.000
130
65
0
0
0.000
132
66
0
0
0.000
n/a
0.000
PMT-272
Exon 16: 3UTRPDE
51381107 GRCh37
49667374 NCBI36
2832 
AAGTCCACAGCTCCTGAGATTGCCT C → T GCAAGTCATCTTGGGCATGAAGCAG
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
n/a
0.000
PMT-272
Exon 16: 3UTRPDEIA
51381077 GRCh37
49667344 NCBI36
2862 
CTGAGAAAGACAGTGTGCTTTGCAA C → T GGTTAAGTCCACAGCTCCTGAGATT
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
3
22
43
0.794
136
0
7
61
0.949
136
0
1
67
0.993
134
0
4
63
0.970
n/a
0.000
PMT-272
Exon 16: 3UTRPDE
51381050 GRCh37
49667317 NCBI36
2889 
CTAACACCTACTGACTTGCAGAGAA C → T GCTGAGAAAGACAGTGTGCTTTGCA
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
68
0
0
0.000
136
66
2
0
0.015
136
68
0
0
0.000
134
67
0
0
0.000
n/a
0.000
PMT-272
Exon 16: 3UTRPDEI
51380893 GRCh37
49667160 NCBI36
3046 
GTGGCTGAAGTAAAAGCAGCAGCTT T → G GTGCTGAAGACACCCATTTCCTCTG
+ 
 
n=
T/T=
T/G=
G/G=
G=
136
43
24
1
0.191
136
68
0
0
0.000
136
68
0
0
0.000
134
66
1
0
0.007
n/a
0.000
PMT-272
Exon 16: 3UTRPDE
51380847 GRCh37
49667114 NCBI36
3092 
TGAGATAATCACACAATCTCAGGCT C → T GGTATGTAAAAATGTCAGAAGTGGC
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
66
2
0
0.015
136
67
1
0
0.007
136
68
0
0
0.000
134
67
0
0
0.000
n/a
0.000
PMT-272
Exon 16: 3UTRPDEI
51380835 GRCh37
49667102 NCBI36
3104 
AGTGATTTGATTTGAGATAATCACA C → T AATCTCAGGCTCGGTATGTAAAAAT
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
53
15
0
0.110
136
40
24
4
0.235
136
56
11
1
0.096
134
56
11
0
0.082
n/a
0.000
PMT-272
Exon 16: 3UTRPDE
51380727 GRCh37
49666994 NCBI36
3212 
CTCTGGAAGGAAAGCTCCAAAAATG A → G GAAGTCCTTCAACACCATTTTCCAT
+ 
 
n=
A/A=
A/G=
G/G=
G=
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
134
66
1
0
0.007
n/a
0.000
PMT-272
Exon 16: 3UTRPDE
51380622 GRCh37
49666889 NCBI36
3317 
CCTTATAAAAGACCATCCATCCAGT C → A TGCGCTTTTGACTGTGTGCAAGTAT
+ 
 
n=
C/C=
C/A=
A/A=
A=
136
66
2
0
0.015
136
68
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
n/a
0.000
PMT-272
Exon 16: 3UTRPDE
51380525 GRCh37
49666792 NCBI36
3414 
TGGTTAGGGGAATTGTCATTCATAA C → T TCTGTGCTATATTACTTGAGGGGCT
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
66
2
0
0.015
136
68
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
n/a
0.000
PMT-272
Exon 16: 3UTRPDE
51380330 GRCh37
49666597 NCBI36
3609 
CACCCAGACCCAGGGCAAAGATACA T → A GTTACCATATCATCTTTATAAAGAA
+ 
 
n=
T/T=
T/A=
A/A=
A=
90
44
1
0
0.011
126
63
0
0
0.000
134
67
0
0
0.000
124
62
0
0
0.000
n/a
0.000
PMT-272
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 16: 3UTRPDEI
51380232 GRCh37
49666499 NCBI36
3707 
TTTTCTATCATTGCAAGTCATAAAT A → G TAACTTTTAAAAGAATACTAGCAGC
+ 
 
n=
A/A=
A/G=
G/G=
G=
90
21
14
10
0.378
126
13
30
20
0.556
134
24
35
8
0.381
124
5
24
33
0.726
n/a
0.000
PMT-272
Exon 16: 3UTRPDE
51380159 GRCh37
49666426 NCBI36
3780 
TAACGTATGAGGGTATTTTTAACAC T → C GTGAAGTACACACATAATATTATAA
+ 
 
n=
T/T=
T/C=
C/C=
C=
90
45
0
0
0.000
126
63
0
0
0.000
134
66
1
0
0.007
124
62
0
0
0.000
n/a
0.000
PMT-272
Exon 16: 3UTRPDE
51380149 GRCh37
49666416 NCBI36
3790 
TCAAATGCAATAACGTATGAGGGTA T → C TTTTAACACTGTGAAGTACACACAT
+ 
 
n=
T/T=
T/C=
C/C=
C=
90
45
0
0
0.000
126
62
1
0
0.008
134
67
0
0
0.000
124
62
0
0
0.000
n/a
0.000
PMT-272
Exon 16: 3UTR
51379963 GRCh37
49666230 NCBI36
3976 
AATTATTTCATGTCACATTTAAGAA GAA → - CAAGAACCAATTTATATAAAGTA
+ 
 
n=
GAA/GAA=
GAA/-=
-/-=
-=
90
44
1
0
0.011
126
63
0
0
0.000
134
67
0
0
0.000
124
62
0
0
0.000
n/a
0.000
PMT-272
Exon 16: 3UTRPDE
51379788 GRCh37
49666055 NCBI36
4151 
CAGGAAACCAAATTGGAAAAAGAAA T → - TTTTTTTTAATTAGAAACCAAGTTT
+ 
 
n=
T/T=
T/-=
-/-=
-=
90
45
0
0
0.000
126
61
2
0
0.016
134
67
0
0
0.000
124
62
0
0
0.000
n/a
0.000
PMT-272
 PDE
51379707 GRCh37
49665974 NCBI36
  
TGGTAGTTGCTGTTTCAGTATTTTT T → - GTATCAAAGTTGTTGTAACCCTATT
+ 
 
n=
T/T=
T/-=
-/-=
-=
134
45
22
0
0.164
136
61
7
0
0.051
136
67
1
0
0.007
132
62
4
0
0.030
n/a
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.