UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:TSC
HGNC Symbol:SLC12A3
HGNC Description:solute carrier family 12 (sodium/chloride transporter), member 3
HGNC ID:10912
Superfamily:SLC
Chromosome:Chr.16(+): 56899119-56949762 GRCh37
Location:16q13
OMIM:600968
OMIM Phenotype:Gitelman syndrome
Accessions:NM_000339
Nucleotide RefSeq:NM_000339
Protein RefSeq:NP_000330
Entrez:6559
Ensembl:ENSG00000070915
Isoforms:4
Evidence:None
Tissues:None
Type:protein-coding
Sets:IV
PharmGKB ID:PA321
HPRD ID:02984
Substrates:None
Trivial Names:NCC, TSC, NCCT
Transcripts:NM_000339.2 [Chr.16(+): 56899119-56949762 GRCh37]
NM_001126107.1 [Chr.16(+): 56899119-56949762 GRCh37]
NM_001126108.1 [Chr.16(+): 56899119-56949762 GRCh37]
XM_005256119.1 [Chr.16(+): 56899119-56947533 GRCh37]
ENST00000262502 [Chr.16(+): 56899123-56948437 GRCh37]
ENST00000438926 [Chr.16(+): 56899119-56949762 GRCh37]
ENST00000563236 [Chr.16(+): 56899123-56948434 GRCh37]
ENST00000563352 [Chr.16(+): 56940938-56947890 GRCh37]
ENST00000566786 [Chr.16(+): 56899119-56947317 GRCh37]
ENST00000569002 [Chr.16(+): 56936134-56938764 GRCh37]
Annotation History:View Events (11)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC12A3.

Variant Data

View all PMT variants for SLC12A3 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC12A3 RESEQUENCING  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC12A3 RESEQUENCING
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
PromoterPDE
56898935 GRCh37
55456436 NCBI36
-184-213
ACTCCAGGACTCAGGGAGTGGCTGG C → G TTTGGGCCAGCCCAGCCCTCCAGAT
+ 
 
n=
C/C=
C/G=
G/G=
G=
120
60
0
0
0.000
132
66
0
0
0.000
130
52
10
3
0.123
132
61
5
0
0.038
PMT-272
PromoterPDEI
56899006 GRCh37
55456507 NCBI36
-113-142
CCACAATCAAATGGTGTTCTGCCTC T → C GGCCCTGTCCGGGGACCCTGCTCAC
+ 
 
n=
T/T=
T/C=
C/C=
C=
120
22
32
6
0.367
132
30
31
5
0.311
130
32
31
2
0.269
132
25
30
11
0.394
PMT-272
PromoterPDE
56899007 GRCh37
55456508 NCBI36
-112-141
CACAATCAAATGGTGTTCTGCCTCT G → C GCCCTGTCCGGGGACCCTGCTCACC
+ 
 
n=
G/G=
G/C=
C/C=
C=
120
44
14
2
0.150
132
50
16
0
0.121
130
50
14
1
0.123
132
49
16
1
0.136
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.