UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:NAS1
HGNC Symbol:SLC13A1
HGNC Description:solute carrier family 13 (sodium/sulfate symporter), member 1
HGNC ID:10916
Superfamily:SLC
Chromosome:Chr.7(-): 122753588-122840025 GRCh37
Location:7q31.32
OMIM:606193
OMIM Phenotype:None
Accessions:AF260824.1
Nucleotide RefSeq:NM_022444
Protein RefSeq:NP_071889
Entrez:6561
Ensembl:ENSG00000081800
Isoforms:1
Evidence:None
Tissues:None
Type:protein-coding
Sets:III
PharmGKB ID:PA322
HPRD ID:08394
Substrates:None
Trivial Names:NAS1, NaSi-1
Transcripts:NM_022444.3 [Chr.7(-): 122753588-122840025 GRCh37]
ENST00000194130 [Chr.7(-): 122753585-122840040 GRCh37]
ENST00000427975 [Chr.7(-): 122754579-122840026 GRCh37]
ENST00000439260 [Chr.7(-): 122755429-122840025 GRCh37]
ENST00000539873 [Chr.7(-): 122755429-122821200 GRCh37]
Annotation History:View Events (2)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC13A1.

Variant Data

View all PMT variants for SLC13A1 on UCSC Genome Browser
Showing SNP features for transcript: NM_022444  
SLC13A1 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC13A1 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
PromoterPDE
122840112 GRCh37
122627348 NCBI36
-87-112
TGAGATTTAATTTTAACTTGTGTTG G → T TCGGTCTAGGGCAGTGAGTGAAGGT
- 
 
n=
G/G=
G/T=
T/T=
T=
158
74
5
0
0.032
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
PromoterPDE
122840081 GRCh37
122627317 NCBI36
-56-81
CTAGGGCAGTGAGTGAAGGTGACAG G → C CTGGAAAAATATTAATCCAAGTTGG
- 
 
n=
G/G=
G/C=
C/C=
C=
158
79
0
0
0.000
160
79
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 1: CodingPDE
122839967 GRCh37
122627203 NCBI36
5934
CTTCAGTTACATTCTGGTTTATCGC C → T GATTTCTCTTCGTGGTTTTCACTGT
-12
Arg → STOP
n=
C/C=
C/T=
T/T=
T=
158
79
0
0
0.000
160
78
2
0
0.013
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 1: CodingPDE
122839925 GRCh37
122627161 NCBI36
10176
TTTCACTGTGTTGGTTTTACTACCT C → T TGCCCATCGTCCTCCACACCAAGGT
-26
Leu = Leu
n=
C/C=
C/T=
T/T=
T=
158
78
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
122839772 GRCh37
122627008 NCBI36
  
TTGACCCTTCATACCTAAAGTCAGG A → T TGGTTGTACATGATGTTTTGGCCAT
- 
 
n=
A/A=
A/T=
T/T=
T=
158
79
0
0
0.000
160
80
0
0
0.000
120
60
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
 PDE
122839766 GRCh37
122627002 NCBI36
  
CTTCATACCTAAAGTCAGGATGGTT G → T TACATGATGTTTTGGCCATTTTCTC
- 
 
n=
G/G=
G/T=
T/T=
T=
158
77
2
0
0.013
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
122839751 GRCh37
122626987 NCBI36
  
CAGGATGGTTGTACATGATGTTTTG G → T CCATTTTCTCCCTTTTTAATAATTA
- 
 
n=
G/G=
G/T=
T/T=
T=
158
76
3
0
0.019
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 2: CodingPDE
122821131 GRCh37
122608367 NCBI36
149124
GGAAGCAGAATGTGCCTACACACTC T → C TTGTGGTCGCCACATTTTGGCTCAC
-42
Phe → Leu
(D=22)
n=
T/T=
T/C=
C/C=
C=
160
80
0
0
0.000
160
80
0
0
0.000
120
60
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
Exon 2: CodingPDE
122821125 GRCh37
122608361 NCBI36
155130
AGAATGTGCCTACACACTCTTTGTG G → A TCGCCACATTTTGGCTCACAGAAGC
-44
Val → Ile
(D=29)
n=
G/G=
G/A=
A/A=
A=
160
80
0
0
0.000
160
79
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
122820919 GRCh37
122608155 NCBI36
  
CAATCATCTCGTTGGTAAGGTTCCA C → T ATAAGTCCCCCAAACTTCCAACTGT
- 
 
n=
C/C=
C/T=
T/T=
T=
160
77
3
0
0.019
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
122820912 GRCh37
122608148 NCBI36
  
CTCGTTGGTAAGGTTCCACATAAGT C → T CCCCAAACTTCCAACTGTTTCTCCT
- 
 
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
160
80
0
0
0.000
120
60
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
 PDE
122820911 GRCh37
122608147 NCBI36
  
TCGTTGGTAAGGTTCCACATAAGTC C → - CCCAAACTTCCAACTGTTTCTCCTC
- 
 
n=
C/C=
C/-=
-/-=
-=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
122820910 GRCh37
122608146 NCBI36
  
CGTTGGTAAGGTTCCACATAAGTCC C → - CCAAACTTCCAACTGTTTCTCCTCT
- 
 
n=
C/C=
C/-=
-/-=
-=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
122820909 GRCh37
122608145 NCBI36
  
GTTGGTAAGGTTCCACATAAGTCCC C → - CAAACTTCCAACTGTTTCTCCTCTC
- 
 
n=
C/C=
C/-=
-/-=
-=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
122820908 GRCh37
122608144 NCBI36
  
TTGGTAAGGTTCCACATAAGTCCCC C → - AAACTTCCAACTGTTTCTCCTCTCT
- 
 
n=
C/C=
C/-=
-/-=
-=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
122820889 GRCh37
122608125 NCBI36
  
GTCCCCCAAACTTCCAACTGTTTCT C → T CTCTCTGGCATTCTGCATGTGTGTC
- 
 
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
160
80
0
0
0.000
120
60
0
0
0.000
100
43
7
0
0.070
12
6
0
0
0.000
Set-II
 PDE
122820805 GRCh37
122608041 NCBI36
  
TTGAGTCATGCATGTCAGTGGGAGA A → C ATGTATGTCCCCTCTTCTCTCACTG
- 
 
n=
A/A=
A/C=
C/C=
C=
160
80
0
0
0.000
160
80
0
0
0.000
120
60
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
 PDE
122812138 GRCh37
122599374 NCBI36
  
GGTATACTTTTCCTTAACACCATTT T → C TGAGTAAGAATATAGAACATGTCTA
- 
 
n=
T/T=
T/C=
C/C=
C=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
122812096 GRCh37
122599332 NCBI36
  
ACATGTCTAAATTTGTATTCAAACA C → T ATCTACATTTTTCTCAACAAAATGG
- 
 
n=
C/C=
C/T=
T/T=
T=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
122812036 GRCh37
122599272 NCBI36
  
GCGGTTGAAGGTCAAAATTAAGAGC A → T GCATAATAATGTCTTTCTTGTGCAA
- 
 
n=
A/A=
A/T=
T/T=
T=
160
80
0
0
0.000
160
72
8
0
0.050
120
53
7
0
0.058
100
50
0
0
0.000
12
5
1
0
0.083
Set-II
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 PDE
122812000 GRCh37
122599236 NCBI36
  
GTCTTTCTTGTGCAATGTTATTTTT C → T CCCACCAAAGTAAATAATCACGGGT
- 
 
n=
C/C=
C/T=
T/T=
T=
160
78
2
0
0.013
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
122811805 GRCh37
122599041 NCBI36
  
TCCTGCATGGTAAGTACTGCATTTA C → T TGCTTCCAGTTTACCTGCTGAACAG
- 
 
n=
C/C=
C/T=
T/T=
T=
160
78
2
0
0.013
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDEI
122811776 GRCh37
122599012 NCBI36
  
TTCCAGTTTACCTGCTGAACAGACC A → G TTTTTGTGCAGAGCAAATAATCAAA
- 
 
n=
A/A=
A/G=
G/G=
G=
160
55
24
1
0.163
160
80
0
0
0.000
120
60
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
Exon 4: CodingPDE
122809302 GRCh37
122596538 NCBI36
478453
CGGCTGCCATGGTGATGCCCATTGC G → A GAGGCTGTAGTGCAGCAGATCATCA
-151
Ala = Ala
n=
G/G=
G/A=
A/A=
A=
160
80
0
0
0.000
160
79
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 4: CodingPDE
122809286 GRCh37
122596522 NCBI36
494469
GCCCATTGCGGAGGCTGTAGTGCAG C → G AGATCATCAATGCAGAAGCAGAGGT
-157
Gln → Glu
(D=29)
n=
C/C=
C/G=
G/G=
G=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 4: CodingPDE
122809275 GRCh37
122596511 NCBI36
505480
AGGCTGTAGTGCAGCAGATCATCAA T → C GCAGAAGCAGAGGTCGAGGCCACTC
-160
Asn = Asn
n=
T/T=
T/C=
C/C=
C=
160
80
0
0
0.000
160
79
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 4: CodingPDE2 pubsI
122809234 GRCh37
122596470 NCBI36
546521
GAGGCCACTCAGATGACTTACTTCA A → G CGGATCAACCAACCACGGACTAGAA
-174
Asn → Ser
(D=46)
n=
A/A=
A/G=
G/G=
G=
160
49
26
5
0.225
160
41
33
6
0.281
120
25
28
7
0.350
100
27
20
3
0.260
12
6
0
0
0.000
Set-II
 PDE
122809157 GRCh37
122596393 NCBI36
  
CCAATCTGGGGTCTAGTCATTAGAG C → T AATAGACATAAACTCAAGAATTCTA
- 
 
n=
C/C=
C/T=
T/T=
T=
160
64
15
1
0.106
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
122809112 GRCh37
122596348 NCBI36
  
ATTCTAAGTTGTATTTTGAATTAAC C → T ATCTATACATGCATGATATGAATTT
- 
 
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
160
80
0
0
0.000
120
60
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
 PDEIA
122809111 GRCh37
122596347 NCBI36
  
TTCTAAGTTGTATTTTGAATTAACC A → G TCTATACATGCATGATATGAATTTA
- 
 
n=
A/A=
A/G=
G/G=
G=
160
20
40
20
0.500
160
6
30
44
0.738
120
6
26
28
0.683
100
1
27
22
0.710
12
3
2
1
0.333
Set-II
 PDE
122809008 GRCh37
122596244 NCBI36
  
ATTTTACCTAAATTGTTACATTTCT A → G TTTGCTTGCAAAAAGAAGAATGCCT
- 
 
n=
A/A=
A/G=
G/G=
G=
160
80
0
0
0.000
160
80
0
0
0.000
120
60
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
 PDE
122809005 GRCh37
122596241 NCBI36
  
TTACCTAAATTGTTACATTTCTATT T → G GCTTGCAAAAAGAAGAATGCCTTTT
- 
 
n=
T/T=
T/G=
G/G=
G=
160
79
1
0
0.006
160
77
3
0
0.019
120
59
1
0
0.008
100
48
2
0
0.020
12
6
0
0
0.000
Set-II
 PDE
122808745 GRCh37
122595981 NCBI36
  

G → A, GTA
TTTGTATTTATAAAATAAGATGACT G → A TTATGTTAGTACACAGTGAATTTTT
TTTGTATTTATAAAATAAGATGACT G → GTA TTATGTTAGTACACAGTGAATTTTT
- 

 
 
 
n=
G/G=
G/A=
A/A=
G/GTA=
GTA/GTA=
A/GTA=
A=
GTA=
160
80
0
0
0
0
0
0.000
0.000
160
80
0
0
0
0
0
0.000
0.000
120
57
0
0
0
0
3
0.025
0.025
100
48
0
0
0
0
2
0.020
0.020
12
6
0
0
0
0
0
0.000
0.000
Set-II
 PDE
122808693 GRCh37
122595929 NCBI36
  
ATTTTCAATTTCTACTAATGCTTCC A → G TCTTCGCATCCACACACAGGCAAAC
- 
 
n=
A/A=
A/G=
G/G=
G=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
122808645 GRCh37
122595881 NCBI36
  
AACCCAATGATAATCCCTTATTTAA A → G TTGTTTTTCTTTTATTTAATGTTTT
- 
 
n=
A/A=
A/G=
G/G=
G=
160
80
0
0
0.000
160
80
0
0
0.000
120
57
3
0
0.025
100
48
2
0
0.020
12
6
0
0
0.000
Set-II
 PDE
122808637 GRCh37
122595873 NCBI36
  
GATAATCCCTTATTTAAATTGTTTT T → - CTTTTATTTAATGTTTTGCAGAAAG
- 
 
n=
T/T=
T/-=
-/-=
-=
160
80
0
0
0.000
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
5
1
0
0.083
Set-II
 PDEI
122808528 GRCh37
122595764 NCBI36
  
GGAATACTGACATTTTGATTGGGAT T → C TTTCCAAATTATATTTTAATAAAAT
- 
 
n=
T/T=
T/C=
C/C=
C=
160
64
16
0
0.100
160
53
22
5
0.200
120
38
19
3
0.208
100
37
13
0
0.130
12
2
3
1
0.417
Set-II
Exon 6: CodingPDE
122808474 GRCh37
122595710 NCBI36
639614
AACTGGATCAATGTATTTTTCAGAT A → G CAATAATGATACAGGGAAAATTTCA
-205
Tyr → Cys
(D=194)
n=
A/A=
A/G=
G/G=
G=
160
77
3
0
0.019
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
122808347 GRCh37
122595583 NCBI36
  
AGTTAGATACATATGCATTTTAAAA C → A CTGCCACTTGCTTCCTTTTCTATAA
- 
 
n=
C/C=
C/A=
A/A=
A=
160
79
1
0
0.006
160
77
3
0
0.019
120
59
1
0
0.008
100
48
2
0
0.020
12
6
0
0
0.000
Set-II
 PDE
122808313 GRCh37
122595549 NCBI36
  
TGCTTCCTTTTCTATAAATTATTTT G → T CTTGACTAAGCAGTAGCATGGTGTA
- 
 
n=
G/G=
G/T=
T/T=
T=
160
53
22
5
0.200
160
43
32
5
0.263
114
26
26
5
0.316
96
29
17
2
0.219
10
4
1
0
0.100
Set-II
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 7: CodingPDEI
122787306 GRCh37
122574542 NCBI36
744719
AAGGGCCACGTGACACGTAAACTTA C → T GTGTTTGTGCATTGCCTACTCTTCT
-240
Thr → Met
(D=81)
n=
C/C=
C/T=
T/T=
T=
160
76
4
0
0.025
160
80
0
0
0.000
120
60
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
 PDE
122786983 GRCh37
122574219 NCBI36
  
AGATTTCCCAGGTCAGCTCAGAGGG G → A ATAACTCTTGGCTGACCACCCTTAA
- 
 
n=
G/G=
G/A=
A/A=
A=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDEI
122786966 GRCh37
122574202 NCBI36
  
TCAGAGGGGATAACTCTTGGCTGAC C → A ACCCTTAACAAACAGGAAAAACATT
- 
 
n=
C/C=
C/A=
A/A=
A=
160
79
1
0
0.006
160
68
11
1
0.081
120
60
0
0
0.000
100
47
3
0
0.030
12
6
0
0
0.000
Set-II
 PDEI
122774729 GRCh37
122561965 NCBI36
  
TCAAGACAGGAGACAAGGGGTAAAA G → T TACTCTATTTAATGATGAGTATATT
- 
 
n=
G/G=
G/T=
T/T=
T=
160
16
43
21
0.531
160
44
31
5
0.256
120
27
27
6
0.325
100
23
25
2
0.290
12
1
2
3
0.667
Set-II
 PDEIA
122774603 GRCh37
122561839 NCBI36
  
CACCTGTCTCTCCATCCCTGAACAC G → T TCTCCATGTTTTCACACAGACGCTA
- 
 
n=
G/G=
G/T=
T/T=
T=
160
15
43
22
0.544
160
58
20
2
0.150
120
34
22
4
0.250
100
30
19
1
0.210
12
2
1
3
0.583
Set-II
Exon 8: CodingPDE
122774566 GRCh37
122561802 NCBI36
855830
TCACACAGACGCTATCCTGACTGTC G → A TTGCCTCAACTTTGGATCATGGTTT
-277
Arg → His
(D=29)
n=
G/G=
G/A=
A/A=
A=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
122774447 GRCh37
122561683 NCBI36
  
AGGATTCAAGTAAGTAAATATTTCA T → C GTTAATAGGCTAAATAAAGGTGTCT
- 
 
n=
T/T=
T/C=
C/C=
C=
160
78
2
0
0.013
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
122769585 GRCh37
122556821 NCBI36
  
TTACAAAAATATCTTCCTTACAGGG A → T GGTGGTAGTAAAAGAATTTCTTGCT
- 
 
n=
A/A=
A/T=
T/T=
T=
160
80
0
0
0.000
160
80
0
0
0.000
120
54
6
0
0.050
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
122769538 GRCh37
122556774 NCBI36
  
TGCTTACAGGCTTAATTATTCTTTG C → T AGTTTTAAGGAGATGTTCAAATGTG
- 
 
n=
C/C=
C/T=
T/T=
T=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 9: CodingPDE
122769473 GRCh37
122556709 NCBI36
1020995
GTCCAACAAAAAGCTTGTGCTGAGG T → C GATTAAGCAAGAATACCAAAAGCTT
-332
Val → Ala
(D=64)
n=
T/T=
T/C=
C/C=
C=
160
80
0
0
0.000
160
80
0
0
0.000
120
58
2
0
0.017
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
122769106 GRCh37
122556342 NCBI36
  
AATTATTGACACATCTAGTTCTTAC A → G GTGTTTAGTGTTCTACTGCGATCAT
- 
 
n=
A/A=
A/G=
G/G=
G=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
122769026 GRCh37
122556262 NCBI36
  
AATGTCCCGACTGAGAAAATAAGAA G → A TGATGCCATTGGAATTTTTCCACAG
- 
 
n=
G/G=
G/A=
A/A=
A=
160
75
5
0
0.031
160
79
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
122768886 GRCh37
122556122 NCBI36
  
CACTTTTTTCAGAGTAAGCTTTGCA C → T GTTATGTTTGTCAGCCCTTCCTGTT
- 
 
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
160
80
0
0
0.000
120
57
3
0
0.025
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDEI
122768724 GRCh37
122555960 NCBI36
  
AAATTATAAGGAATGAAATCTAGGA T → C AAGAGCACAGAAAGAATAACCATAT
- 
 
n=
T/T=
T/C=
C/C=
C=
160
60
19
1
0.131
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
122765922 GRCh37
122553158 NCBI36
  
ATGGGAACAATAAGACTATGGTCTG A → C GATTATTGTTTTTAGTGTTGTGTCA
- 
 
n=
A/A=
A/C=
C/C=
C=
160
80
0
0
0.000
160
79
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
122765889 GRCh37
122553125 NCBI36
  
GTTTTTAGTGTTGTGTCATTTAATC G → A GGAATCCATATATTTTAGGGCAGAT
- 
 
n=
G/G=
G/A=
A/A=
A=
160
80
0
0
0.000
160
79
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 11: CodingPDE
122765688 GRCh37
122552924 NCBI36
12001175
ACAGATTCAACTGTTGCTTTACTTA T → C AGGGCTGCTATTCTTTCTTATCCCA
-392
Ile → Thr
(D=89)
n=
T/T=
T/C=
C/C=
C=
160
80
0
0
0.000
160
80
0
0
0.000
120
60
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
 PDE
122765564 GRCh37
122552800 NCBI36
  
ACAGAAGAGCAAAAATTACAAAATT C → T CATTGGTTTCGCTTGGCACCTAGAG
- 
 
n=
C/C=
C/T=
T/T=
T=
160
78
2
0
0.013
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
122765533 GRCh37
122552769 NCBI36
  
GTTTCGCTTGGCACCTAGAGCAGAA A → - GAAAGTCTATGCTGGCACAATCCCT
- 
 
n=
A/A=
A/-=
-/-=
-=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
122765532 GRCh37
122552768 NCBI36
  
TTTCGCTTGGCACCTAGAGCAGAAA G → - AAAGTCTATGCTGGCACAATCCCTG
- 
 
n=
G/G=
G/-=
-/-=
-=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 PDE
122765434 GRCh37
122552670 NCBI36
  
ACAGCTTCCACCTTCAAGAGAGATC G → A TCTTACTTTGCAGAAGTGAGAAGTA
- 
 
n=
G/G=
G/A=
A/A=
A=
160
80
0
0
0.000
160
79
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
122763134 GRCh37
122550370 NCBI36
  
TATTTAACAATTAACCAGACTGTTC A → G AAAGAAGAGCACAGAGACATTCAAT
- 
 
n=
A/A=
A/G=
G/G=
G=
160
80
0
0
0.000
160
80
0
0
0.000
120
60
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
 PDE
122763039 GRCh37
122550275 NCBI36
  
TTTTGCTAGCTATGCAGTGAATATA C → T CACACAAATGAGATGAGTTCAGAGT
- 
 
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
160
79
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
122762844 GRCh37
122550080 NCBI36
  
TGTAAAGTGACTCCTAGTGAAATAT A → G CTTTTCGTTTGCTTATGCCTTTACC
- 
 
n=
A/A=
A/G=
G/G=
G=
160
80
0
0
0.000
160
80
0
0
0.000
120
60
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
 PDE
122762842 GRCh37
122550078 NCBI36
  
TAAAGTGACTCCTAGTGAAATATAC T → C TTTCGTTTGCTTATGCCTTTACCTT
- 
 
n=
T/T=
T/C=
C/C=
C=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
122759439 GRCh37
122546675 NCBI36
  
TTCCTACCAAAGCCACCCAGACCTA C → T CAAACCACAGAAAAAAAGAGAGATT
- 
 
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
5
1
0
0.083
Set-II
 PDE
122759092 GRCh37
122546328 NCBI36
  
CCCCTTTTTACTCTTCATTAAGAGC A → G GTACTCTGCTTCGGAATGCTGGTTT
- 
 
n=
A/A=
A/G=
G/G=
G=
160
80
0
0
0.000
160
80
0
0
0.000
120
60
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
 PDE
122759041 GRCh37
122546277 NCBI36
  
TCATGTTGTGGTATGGAATCTCTTT T → C GGTCTAAATGGGCCTCCTGTAAGTA
- 
 
n=
T/T=
T/C=
C/C=
C=
160
77
3
0
0.019
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 
122757506 GRCh37
122544742 NCBI36
  
TGACATGGTGAGTTAGCTGAAAAAA A → AA TACTATCAAATCCAATACACATCTT
- 
 
n=
A/A=
A/AA=
AA/AA=
AA=
160
75
5
0
0.031
160
38
36
6
0.300
120
46
13
1
0.125
100
24
21
5
0.310
12
6
0
0
0.000
Set-II
 PDEA
122757443 GRCh37
122544679 NCBI36
  
GTCTTGAATTATCTTCCCTTTTATA C → T ACCAATCAACCACCAGGAAAAGCAG
- 
 
n=
C/C=
C/T=
T/T=
T=
160
73
6
1
0.050
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
122755881 GRCh37
122543117 NCBI36
  
GACCCATGTATACATATGTAACAAA C → T CTGCACGTTGTGCACATGTACCCTA
- 
 
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
160
80
0
0
0.000
120
51
9
0
0.075
100
43
7
0
0.070
12
6
0
0
0.000
Set-II
 PDE
122755879 GRCh37
122543115 NCBI36
  
CCCATGTATACATATGTAACAAACC T → A GCACGTTGTGCACATGTACCCTAGA
- 
 
n=
T/T=
T/A=
A/A=
A=
160
75
5
0
0.031
160
79
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
122755819 GRCh37
122543055 NCBI36
  
ATAATTTAAAAAATGACAATTTATA C → T TAATCATTTAGGATGCATGTAAATT
- 
 
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
160
79
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
122755768 GRCh37
122543004 NCBI36
  
TGGCATATACATCCTACAATAGGAT T → C CTAATCTCCTGTAGGCTTTCTTCTG
- 
 
n=
T/T=
T/C=
C/C=
C=
160
80
0
0
0.000
160
79
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 15: 3UTRPDE
122755571 GRCh37
122542807 NCBI36
1814 
TATGAGTAATGAGACCATGCCATAA T → C AAGCACAAAATTTCTGACTATCTTG
- 
 
n=
T/T=
T/C=
C/C=
C=
160
80
0
0
0.000
160
79
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 15: 3UTRPDE
122755455 GRCh37
122542691 NCBI36
1930 
ATTTAAATCAGTTATGGTGTAGCTG C → A TGCAATTCCCGTGAATACCCGAAAC
- 
 
n=
C/C=
C/A=
A/A=
A=
160
80
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 15: 3UTRPDEIA
122755445 GRCh37
122542681 NCBI36
1940 
GTTATGGTGTAGCTGCTGCAATTCC C → T GTGAATACCCGAAACCTGCTGTTAT
- 
 
n=
C/C=
C/T=
T/T=
T=
160
60
19
1
0.131
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 15: 3UTRPDE
122755434 GRCh37
122542670 NCBI36
1951 
GCTGCTGCAATTCCCGTGAATACCC G → A AAACCTGCTGTTATAACTCAGAGTC
- 
 
n=
G/G=
G/A=
A/A=
A=
160
80
0
0
0.000
160
79
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.