UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:NaDC1
HGNC Symbol:SLC13A2
HGNC Description:solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 2
HGNC ID:10917
Superfamily:SLC
Chromosome:Chr.17(+): 26800664-26824799 GRCh37
Location:17p13.2
OMIM:604148
OMIM Phenotype:None
Accessions:U26209
Nucleotide RefSeq:NM_003984
Protein RefSeq:NP_003975
Entrez:9058
Ensembl:ENSG00000007216
Isoforms:2
Evidence:None
Tissues:None
Type:protein-coding
Sets:II
PharmGKB ID:PA382
HPRD ID:09164
Substrates:None
Trivial Names:NaCT, NADC1, SDCT1, NaDC-1
Transcripts:NM_003984.3 [Chr.17(+): 26800664-26824799 GRCh37]
NM_001145975.1 [Chr.17(+): 26800664-26824799 GRCh37]
ENST00000314669 [Chr.17(+): 26800311-26824799 GRCh37]
ENST00000444914 [Chr.17(+): 26800311-26824796 GRCh37]
ENST00000459818 [Chr.17(+): 26800756-26824796 GRCh37]
ENST00000537681 [Chr.17(+): 26800756-26824796 GRCh37]
ENST00000541739 [Chr.17(+): 26800756-26821094 GRCh37]
ENST00000545060 [Chr.17(+): 26800664-26824796 GRCh37]
ENST00000577903 [Chr.17(+): 26800710-26824336 GRCh37]
ENST00000579281 [Chr.17(+): 26800756-26824712 GRCh37]
Annotation History:View Events (9)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC13A2.

Variant Data

View all PMT variants for SLC13A2 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC13A2 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC13A2 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 2: CodingPDE1 pub
26816259 GRCh37
23840386 NCBI36
197130
GGCCTACTGCGCGTATGCCATCATC C → T TCATGGCGCTCTTCTGGTGCACTGA
+44
Leu → Phe
(D=22)
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 2: CodingPDE
26816345 GRCh37
23840472 NCBI36
283216
TAATCCTGTTCCCTATGATGGGCAT C → T GTGGATGCCTCTGAGGTGAGCCCCA
+72
Ile = Ile
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 2: CodingPDE
26816348 GRCh37
23840475 NCBI36
286219
TCCTGTTCCCTATGATGGGCATCGT G → A GATGCCTCTGAGGTGAGCCCCATCC
+73
Val = Val
n=
G/G=
G/A=
A/A=
A=
160
80
0
0
0.000
160
79
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
26816369 GRCh37
23840496 NCBI36
  
TCGTGGATGCCTCTGAGGTGAGCCC C → CC ATCCATAGGAGAAAGCGTTCTGGGC
+ 
 
n=
C/C=
C/CC=
CC/CC=
CC=
160
24
43
13
0.431
160
30
36
14
0.400
120
32
24
4
0.267
100
10
24
16
0.560
12
1
3
2
0.583
Set-II
 PDE
26817447 GRCh37
23841574 NCBI36
  
TGGGAGACTCCAGGGTCTTCCCGCC G → A CTCAGCCATGTCTCCACCTGCCAGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 3: CodingPDE
26817516 GRCh37
23841643 NCBI36
343276
AGGACTCCAACCTCCTGTTCTTCGG G → A GGGCTGCTGGTGGCCATCGCGGTGG
+92
Gly = Gly
n=
G/G=
G/A=
A/A=
A=
160
66
13
1
0.094
160
80
0
0
0.000
120
60
0
0
0.000
100
48
2
0
0.020
12
6
0
0
0.000
Set-II
Exon 3: CodingPDE1 pubIA
26817537 GRCh37
23841664 NCBI36
364297
TCGGGGGGCTGCTGGTGGCCATCGC G → A GTGGAACACTGGAACCTGCATAAAC
+99
Ala = Ala
n=
G/G=
G/A=
A/A=
A=
160
53
23
4
0.194
160
41
36
3
0.263
120
58
2
0
0.017
100
31
19
0
0.190
12
6
0
0
0.000
Set-II
Exon 3: CodingPDE1 pub
26817589 GRCh37
23841716 NCBI36
416349
CATCGCCCTCCGTGTCCTCCTCATC G → A TTGGGGTGCGGCCTGCCCCGTGAGT
+117
Val → Ile
(D=29)
n=
G/G=
G/A=
A/A=
A=
160
80
0
0
0.000
160
79
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
26817629 GRCh37
23841756 NCBI36
  
GCCCCGTGAGTTCCTCCTGCAAACC A → G GCACGGGAGAACCTGACGAGGAGAT
+ 
 
n=
A/A=
A/G=
G/G=
G=
160
80
0
0
0.000
160
79
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
26818422 GRCh37
23842549 NCBI36
  
CCCGTTCCCCAGAGCTGGCCCTGTA C → T CTGCCCCCACCTGGGCTCTCCCTTG
+ 
 
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
26818436 GRCh37
23842563 NCBI36
  
CTGGCCCTGTACCTGCCCCCACCTG G → A GCTCTCCCTTGTTCCCAGATAATGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
160
80
0
0
0.000
160
79
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDEI
26818447 GRCh37
23842574 NCBI36
  
CCTGCCCCCACCTGGGCTCTCCCTT G → T TTCCCAGATAATGGGCAGGCCCTCC
+ 
 
n=
G/G=
G/T=
T/T=
T=
160
54
25
1
0.169
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
26818666 GRCh37
23842793 NCBI36
  
TGACAAGGGGTGGGCCACCTTGGGG G → A ATCTGCACATTCACTGGGAGGTGAA
+ 
 
n=
G/G=
G/A=
A/A=
A=
160
75
5
0
0.031
160
79
1
0
0.006
120
60
0
0
0.000
100
48
2
0
0.020
12
6
0
0
0.000
Set-II
 PDEI
26818676 GRCh37
23842803 NCBI36
  
TGGGCCACCTTGGGGGATCTGCACA T → C TCACTGGGAGGTGAATGGGGCTGGG
+ 
 
n=
T/T=
T/C=
C/C=
C=
160
0
0
80
1.000
160
0
4
76
0.975
120
0
12
48
0.900
100
0
2
48
0.980
12
0
0
6
1.000
Set-II
 PDE
26818686 GRCh37
23842813 NCBI36
  
TGGGGGATCTGCACATTCACTGGGA G → A GTGAATGGGGCTGGGCAGTTCTCGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
160
80
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 6: CodingPDE1 pub
26818752 GRCh37
23842879 NCBI36
827760
CAGCCCATGTTCCTCCTTCAGGCTC T → C TCCCCCAAAACGGCAACGTGGTGAA
+254
Phe → Leu
(D=22)
n=
T/T=
T/C=
C/C=
C=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 7: CodingPDE1 pub
26820638 GRCh37
23844765 NCBI36
995928
GGAAAAGATGCAGGAGCAACAGCAG G → C CAGCCTACTGCGTCATCCAGACCGA
+310
Ala → Pro
(D=27)
n=
G/G=
G/C=
C/C=
C=
160
80
0
0
0.000
160
80
0
0
0.000
120
60
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
Exon 7: CodingPDE
26820775 GRCh37
23844902 NCBI36
11321065
AGCCGGGCTTTTTTCTTGGCTGGGG C → A AATTTGGCTTTTCCCAATGCCAAGG
+355
Gly = Gly
n=
C/C=
C/A=
A/A=
A=
160
80
0
0
0.000
160
80
0
0
0.000
120
60
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
 PDE
26820816 GRCh37
23844943 NCBI36
  
AATGCCAAGGGGGAGAGGTGAGAGT T → C GCAGGGGTTGGGAGGAGGACACATC
+ 
 
n=
T/T=
T/C=
C/C=
C=
160
80
0
0
0.000
160
80
0
0
0.000
120
56
4
0
0.033
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
26820997 GRCh37
23845124 NCBI36
  
CCTGTGGCCCTGAGCAACCCCAAGC G → A GCTAACCCAGCCCTCCCCGCGCCCC
+ 
 
n=
G/G=
G/A=
A/A=
A=
160
79
1
0
0.006
160
76
3
1
0.031
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 8: CodingPDE1 pub
26821090 GRCh37
23845217 NCBI36
12201153
CATCGGCATAATTATGTTCATCATA C → T CCTCCAAGTTCCCAGGGCTGACCCA
+385
Pro → Ser
(D=74)
n=
C/C=
C/T=
T/T=
T=
160
79
1
0
0.006
160
80
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 8: CodingPDE
26821119 GRCh37
23845246 NCBI36
12491182
CCAAGTTCCCAGGGCTGACCCAGGA C → T CCAGGTAAGCACCTGGACTGGGGCA
+394
Asp = Asp
n=
C/C=
C/T=
T/T=
T=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDEI
26821344 GRCh37
23845471 NCBI36
  
CAAAAGGGACCCACACAGGGAGCCC G → A CAAATGGAGAGGGGAAAGGCCTGTT
+ 
 
n=
G/G=
G/A=
A/A=
A=
160
63
16
1
0.113
160
80
0
0
0.000
120
60
0
0
0.000
100
47
3
0
0.030
12
6
0
0
0.000
Set-II
 PDE
26821570 GRCh37
23845697 NCBI36
  
GCCCCCTCCTCAGCCTGTGTGAGGG T → A GTCTCTGTGGCAGGGAGAGAGGGGG
+ 
 
n=
T/T=
T/A=
A/A=
A=
160
76
4
0
0.025
160
79
1
0
0.006
120
59
1
0
0.008
100
38
12
0
0.120
12
6
0
0
0.000
Set-II
 PDE
26822610 GRCh37
23846737 NCBI36
  
CAGGAGCAGGAGCCTCATAGAGCCT C → T GGCAGAAGACTTGGGGGCCCAGGCA
+ 
 
n=
C/C=
C/T=
T/T=
T=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 10: CodingPDE
26822678 GRCh37
23846805 NCBI36
13811314
CCATCCTCCTCTGCCCACAGCGATC G → A GGCCTGTCAGAGTGGCTGGGAAACA
+438
Ser = Ser
n=
G/G=
G/A=
A/A=
A=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 10: CodingPDE1 pub
26822793 GRCh37
23846920 NCBI36
14961429
CACCTTCACCGAGTGCACTAGCAAC G → A TGGCCACCACTACGATCTTCCTGCC
+477
Val → Met
(D=21)
n=
G/G=
G/A=
A/A=
A=
160
80
0
0
0.000
160
80
0
0
0.000
120
60
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
 PDE
26822872 GRCh37
23846999 NCBI36
  
TCAGAAACACCTCCTCCAGGCAGCC C → T GCCTGCCTGCCCCACCAGGGGTTCT
+ 
 
n=
C/C=
C/T=
T/T=
T=
160
75
5
0
0.031
160
79
1
0
0.006
120
59
1
0
0.008
100
39
11
0
0.110
12
6
0
0
0.000
Set-II
Exon 12: CodingPDE2 pubsIA
26824156 GRCh37
23848283 NCBI36
17151648
CCTCCTCAACATCATTGGAGTCCTG A → G TCATCGCACTGGCCATCAACAGCTG
+550
Ile → Val
(D=29)
n=
A/A=
A/G=
G/G=
G=
160
14
34
32
0.613
160
33
32
15
0.388
120
29
26
5
0.300
100
6
29
15
0.590
12
1
2
3
0.667
Set-II
Exon 12: CodingPDE
26824161 GRCh37
23848288 NCBI36
17201653
TCAACATCATTGGAGTCCTGATCAT C → T GCACTGGCCATCAACAGCTGGGGCA
+551
Ile = Ile
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
5
1
0
0.083
Set-II
Exon 12: CodingPDE
26824185 GRCh37
23848312 NCBI36
17441677
TCGCACTGGCCATCAACAGCTGGGG C → T ATCCCCCTCTTCAGCCTGCACTCTT
+559
Gly = Gly
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 12: CodingPDE
26824272 GRCh37
23848399 NCBI36
18311764
GCCTGCCAAGCCTGGCCAACACCAC C → - ACACCAAGCCCCTAGGCTGGGGCAC
+588
Thr → DEL
n=
C/C=
C/-=
-/-=
-=
160
80
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 12: CodingPDE
26824273 GRCh37
23848400 NCBI36
18321765
CCTGCCAAGCCTGGCCAACACCACC A → - CACCAAGCCCCTAGGCTGGGGCACA
+589
Thr → DEL
n=
A/A=
A/-=
-/-=
-=
160
80
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 12: CodingPDE
26824274 GRCh37
23848401 NCBI36
18331766
CTGCCAAGCCTGGCCAACACCACCA C → - ACCAAGCCCCTAGGCTGGGGCACAG
+589
Thr → DEL
n=
C/C=
C/-=
-/-=
-=
160
80
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 12: 3UTR
26824377 GRCh37
23848504 NCBI36
1936 
GGGACACCCCAAGCTCCAAGCTCCA A → - GCTCCAGGCCAAAGGCTGAAAGGCA
+ 
 
n=
A/A=
A/-=
-/-=
-=
160
63
16
1
0.113
160
80
0
0
0.000
120
60
0
0
0.000
100
47
3
0
0.030
12
6
0
0
0.000
Set-II
Exon 12: 3UTRPDE
26824378 GRCh37
23848505 NCBI36
1937 
GGACACCCCAAGCTCCAAGCTCCAA G → - CTCCAGGCCAAAGGCTGAAAGGCAC
+ 
 
n=
G/G=
G/-=
-/-=
-=
160
63
16
1
0.113
160
80
0
0
0.000
120
60
0
0
0.000
100
47
3
0
0.030
12
6
0
0
0.000
Set-II
Exon 12: 3UTRPDE
26824379 GRCh37
23848506 NCBI36
1938 
GACACCCCAAGCTCCAAGCTCCAAG C → - TCCAGGCCAAAGGCTGAAAGGCACG
+ 
 
n=
C/C=
C/-=
-/-=
-=
160
63
16
1
0.113
160
80
0
0
0.000
120
60
0
0
0.000
100
47
3
0
0.030
12
6
0
0
0.000
Set-II
Exon 12: 3UTRPDE
26824380 GRCh37
23848507 NCBI36
1939 
ACACCCCAAGCTCCAAGCTCCAAGC T → - CCAGGCCAAAGGCTGAAAGGCACGT
+ 
 
n=
T/T=
T/-=
-/-=
-=
160
63
16
1
0.113
160
80
0
0
0.000
120
60
0
0
0.000
100
47
3
0
0.030
12
6
0
0
0.000
Set-II
Exon 12: 3UTRPDE
26824381 GRCh37
23848508 NCBI36
1940 
CACCCCAAGCTCCAAGCTCCAAGCT C → - CAGGCCAAAGGCTGAAAGGCACGTG
+ 
 
n=
C/C=
C/-=
-/-=
-=
160
63
16
1
0.113
160
80
0
0
0.000
120
60
0
0
0.000
100
47
3
0
0.030
12
6
0
0
0.000
Set-II
Exon 12: 3UTR
26824382 GRCh37
23848509 NCBI36
1941 
ACCCCAAGCTCCAAGCTCCAAGCTC C → - AGGCCAAAGGCTGAAAGGCACGTGT
+ 
 
n=
C/C=
C/-=
-/-=
-=
160
63
16
1
0.113
160
80
0
0
0.000
120
60
0
0
0.000
100
47
3
0
0.030
12
6
0
0
0.000
Set-II
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 12: 3UTRPDE
26824383 GRCh37
23848510 NCBI36
1942 

A → AAGCTCCA, -
CCCCAAGCTCCAAGCTCCAAGCTCC A → - GGCCAAAGGCTGAAAGGCACGTGTG
CCCCAAGCTCCAAGCTCCAAGCTCC A → AAGCTCCA GGCCAAAGGCTGAAAGGCACGTGTG
+ 

 
 
 
n=
A/A=
A/-=
-/-=
A/AAGCTCCA=
AAGCTCCA/AAGCTCCA=
-/AAGCTCCA=
-=
AAGCTCCA=
160
63
16
1
0
0
0
0.113
0.000
160
80
0
0
0
0
0
0.000
0.000
120
60
0
0
0
0
0
0.000
0.000
100
47
3
0
0
0
0
0.030
0.000
12
5
0
0
1
0
0
0.000
0.083
Set-II

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.