UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:PEPT1
HGNC Symbol:SLC15A1
HGNC Description:solute carrier family 15 (oligopeptide transporter), member 1
HGNC ID:10920
Superfamily:SLC
Chromosome:Chr.13(-): 99336055-99404929 GRCh37
Location:13q32.3
OMIM:600544
OMIM Phenotype:None
Accessions:U21936
Nucleotide RefSeq:NM_005073
Protein RefSeq:NP_005064
Entrez:6564
Ensembl:ENSG00000088386
Isoforms:1
Evidence:Substrate In Vitro Evidence: Glycylsarcosine was shown to be transported by PEPT1 in HeLa cells expressing PEPT1 using the vaccinia virus expression system, and in PEPT1-injected X. laevis oocytes (Liang R, Fei YJ, Prasad PD, Ramamoorthy S, Han H, Yang-Feng TL, Hediger MA, Ganapathy V, Leibach FH. Human intestinal H+/peptide cotransporter: cloning, functional expression, and chromosomal localization. J Biol Chem 270(12):6456-63, 1995). Uptake of glycylsarcosine was inhibited by di- and tri-peptides (Ala-Pro, Leu-Pro, Gly-Pro, Ala-Pro-Gly, Gly-Gly-Ile, Gly-Gly-Pro) and by beta-lactam antibiotics (cyclacillin, cephadroxil, cephalexin). When expressed in X. laevis oocytes, PEPT1 was found to transport L-Dopa-L-Phe, synthesized as a dipeptide derivative of L-dopa in an effort to take advantage of PEPT transporters for improved oral bioavailability of L-dopa (Tamai I, Nakanishi T, Nakahara H, Sai Y, Ganapathy V, Leibach FH, Tsuji A. Improvement of L-dopa absorption by dipeptidyl derivation, utilizing peptide transporter PepT1. J Pharm Sci 87(12):1542-1546, 1998). Caco-2 cells are known to express PEPT1, and uptake of fosinopril at the apical membrane of Caco-2 cells is suggested to be mediated by this transporter (Shu C, Shen H, Hopfer U, Smith DE. Mechanism of intestinal absorption and renal reabsorption of an orally active ace inhibitor: uptake and transport of fosinopril in cell cultures. Drug Metab Dispos 29(10):1307-1315, 2001). Similarly, uptake of the dopamine D2 receptor antagonist sulpiride in Caco-2 cells was suggested to be due to PEPT1 expression (Watanabe K, Sawano T, Terada K, Endo T, Sakata M, Sato J. Studies on intestinal absorption of sulpiride (1): carrier-mediated uptake of sulpiride in the human intestinal cell line Caco-2. Biol Pharm Bull 25(7):885-890, 2002). Substrate In Vivo Evidence: A role for PEPT1 in inflammatory processes was suggested by its increased expression in inflamed colonic tissues, and its ability to transport formyl-Met-Leu-Phe (fMLP), a neutrophile attractant peptide found in certain bacterial species (Merlin D, Si-Tahar M, Sitaraman SV, Eastburn K, Williams I, Liu X, Hediger MA, Madara JL. Colonic epithelial hPepT1 expression occurs in inflammatory bowel disease: transport of bacterial peptides influences expression of MHC class 1 molecules. Gastroenterology 120:1666-1679, 2001). Tissue Distribution Evidence: Northern blot analysis revealed high expression of PEPT1 in human ileum, as well as in placenta, liver, kidney, and pancreas (Liang R, Fei YJ, Prasad PD, Ramamoorthy S, Han H, Yang-Feng TL, Hediger MA, Ganapathy V, Leibach FH. Human intestinal H+/peptide cotransporter: cloning, functional expression, and chromosomal localization. J Biol Chem 270(12):6456-63, 1995).
Tissues:Ileum, placenta, liver, kidney, pancreas
Type:protein-coding
Sets:I,IV
PharmGKB ID:PA323
HPRD ID:02768
Substrates:Glycylsarcosine, L-Dopa-L-Phe, fosinopril, sulpiride
Trivial Names:PEPT1, HPECT1, HPEPT1
Transcripts:NM_005073.3 [Chr.13(-): 99336055-99404929 GRCh37]
ENST00000376494 [Chr.13(-): 99372781-99378821 GRCh37]
ENST00000376503 [Chr.13(-): 99336055-99404908 GRCh37]

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC15A1.

Variant Data

View all PMT variants for SLC15A1 on UCSC Genome Browser
Showing SNP features for transcript: NM_005073  
SLC15A1 RESEQUENCING  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC15A1 RESEQUENCING
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
PromoterPDE
99405142 GRCh37
98203143 NCBI36
-213-290
GACCTCCTGAGTCAGCTGGCCGGGG G → T GTGGGGCCTGGGAATCCGCGTTTAG
- 
 
n=
G/G=
G/T=
T/T=
T=
124
51
11
0
0.089
54
27
0
0
0.000
92
46
0
0
0.000
104
52
0
0
0.000
n/a
0.000
PMT-272
PromoterPDE
99405107 GRCh37
98203108 NCBI36
-178-255
GGGAATCCGCGTTTAGACTGGCTCT C → T CCCCGGCCTGCCACGCGCTCCCGTC
- 
 
n=
C/C=
C/T=
T/T=
T=
124
61
1
0
0.008
54
27
0
0
0.000
92
46
0
0
0.000
104
52
0
0
0.000
n/a
0.000
PMT-272
PromoterPDE
99405048 GRCh37
98203049 NCBI36
-119-196
CCCGCACCTGGGCCGGGGCTGGTGT C → T CACGCGCGACGGCTCGGGAGCACGG
- 
 
n=
C/C=
C/T=
T/T=
T=
124
62
0
0
0.000
54
26
1
0
0.019
92
46
0
0
0.000
104
52
0
0
0.000
n/a
0.000
PMT-272
PromoterPDE
99405018 GRCh37
98203019 NCBI36
-89-166
CGCGACGGCTCGGGAGCACGGACCT C → T TGCTCCCCGCAGCACCGCCCCCCGG
- 
 
n=
C/C=
C/T=
T/T=
T=
124
51
11
0
0.089
54
27
0
0
0.000
92
46
0
0
0.000
104
52
0
0
0.000
n/a
0.000
PMT-272
Exon 1: 5UTR
Promoter
PDE1 pub
99404925 GRCh37
98202926 NCBI36
5-73
GGGGCAACGGGGCCGGGCCTGGACG T → C CAGGTCGGAGGAGTAGCACCTGCCA
- 
 
n=
T/T=
T/C=
C/C=
C=
196
86
12
0
0.061
198
99
0
0
0.000
54
27
0
0
0.000
18
9
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 1: 5UTR
Promoter
PDE1 pub
99404885 GRCh37
98202886 NCBI36
45-33
AGCACCTGCCAGGAGCACGTCCCGC C → T GGCAGGTCGCAGGAGCCCTGGGAGC
- 
 
n=
C/C=
C/T=
T/T=
T=
196
97
1
0
0.005
198
95
4
0
0.020
54
25
2
0
0.037
18
9
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 1: 5UTRPDE1 pub
99404872 GRCh37
98202873 NCBI36
58-20
AGCACGTCCCGCCGGCAGGTCGCAG G → - AGCCCTGGGAGCCGCCGCCATGGGT
- 
 
n=
G/G=
G/-=
-/-=
-=
124
62
0
0
0.000
54
26
1
0
0.019
92
46
0
0
0.000
104
52
0
0
0.000
n/a
0.000
PMT-272
 PDE
99404841 GRCh37
98202842 NCBI36
  
TGGGAGCCGCCGCCATGGGTACGCT C → T GGCGGGTGGGGGGCCGGCCGGGCTA
- 
 
n=
C/C=
C/T=
T/T=
T=
188
94
0
0
0.000
186
92
1
0
0.005
54
27
0
0
0.000
18
9
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
99404833 GRCh37
98202834 NCBI36
  
GCCGCCATGGGTACGCTCGGCGGGT G → A GGGGGCCGGCCGGGCTAAAGACTCG
- 
 
n=
G/G=
G/A=
A/A=
A=
188
94
0
0
0.000
186
93
0
0
0.000
54
27
0
0
0.000
18
9
0
0
0.000
14
5
2
0
0.143
Set-I
 PDE
99379053 GRCh37
98177054 NCBI36
  
TCTCTACATATCTTCATCTTGTAAA T → A TTTATCATCTGTTTTACCCCTAAGG
- 
 
n=
T/T=
T/A=
A/A=
A=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDEI
99378743 GRCh37
98176744 NCBI36
  
CTCCTTTGTGGCTATGGACCAGTGG G → C GGGTGTATTTCAATCCTGTGCTTGT
- 
 
n=
G/G=
G/C=
C/C=
C=
200
98
2
0
0.010
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 3: CodingPDE1 pubI
99378664 GRCh37
98176665 NCBI36
13861
TCCCCTGAGCATCTTCTTCATCGTG G → A TCAATGAGTTTTGCGAAAGATTTTC
-21
Val → Ile
(D=29)
n=
G/G=
G/A=
A/A=
A=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 3: CodingPDE1 pubI
99378642 GRCh37
98176643 NCBI36
16083
GTGGTCAATGAGTTTTGCGAAAGAT T → A TTCCTACTATGGAATGCGAGGTAAC
Reduced cephalexin uptake in transfected cells. PMID: 19940846.
-28
Phe → Tyr
(D=22)
n=
T/T=
T/A=
A/A=
A=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
99378567 GRCh37
98176568 NCBI36
  
AGGGAAGAGCGGGAGTGGCCATAAC C → - AGTCCTAACTTTGTTTCCCCCTCCT
- 
 
n=
C/C=
C/-=
-/-=
-=
200
80
20
0
0.100
200
85
15
0
0.075
60
23
7
0
0.117
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
99376311 GRCh37
98174312 NCBI36
  
GGATGGCTATTGTGCAATTAACTCG G → A ATTCTCTTAATCTTTGGAAACACAG
- 
 
n=
G/G=
G/A=
A/A=
A=
198
98
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 5: CodingPDE1 pubI
99376273 GRCh37
98174274 NCBI36
335258
TTTGGAAACACAGGACCATTGTGTC G → A CTCTCCATTGTCTACACAATTGGAC
-86
Ser = Ser
n=
G/G=
G/A=
A/A=
A=
198
98
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 5: CodingPDE1 pubI
99376201 GRCh37
98174202 NCBI36
407330
CCATTAATGACCTCACAGACCACAA C → T CATGATGGCACCCCCGACAGCCTTC
-110
Asn = Asn
n=
C/C=
C/T=
T/T=
T=
198
97
2
0
0.010
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 5: CodingPDE6 pubsIA
99376181 GRCh37
98174182 NCBI36
427350
CACAACCATGATGGCACCCCCGACA G → A CCTTCCTGTGCACGTGTGAGTTGGT
-117
Ser → Asn
(D=46)
n=
G/G=
G/A=
A/A=
A=
198
46
46
7
0.303
200
76
21
3
0.135
60
7
16
7
0.500
20
5
5
0
0.250
14
6
1
0
0.071
Set-I
Exon 5: CodingPDE1 pub
99376180 GRCh37
98174181 NCBI36
428351
ACAACCATGATGGCACCCCCGACAG C → A CTTCCTGTGCACGTGTGAGTTGGTG
-117
Ser → Arg
(D=110)
n=
C/C=
C/A=
A/A=
A=
198
98
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 5: CodingPDE2 pubsIA
99376167 GRCh37
98174168 NCBI36
441364
CACCCCCGACAGCCTTCCTGTGCAC G → A TGTGAGTTGGTGCTCACTGCTGCCC
-122
Val → Met
(D=21)
n=
G/G=
G/A=
A/A=
A=
198
95
4
0
0.020
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 PDEI
99371449 GRCh37
98169450 NCBI36
  
TGAATTAATAGAAGCCTAGGACCAG G → A TCAGGCCCTACGTGAATGATTGTGA
- 
 
n=
G/G=
G/A=
A/A=
A=
200
100
0
0
0.000
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 11: CodingPDE1 pubI
99364165 GRCh37
98162166 NCBI36
920843
TCATCTCCCAAATTAAGATGGTTAC G → A AGGGTGATGTTCCTGTATATTCCAC
-281
Thr = Thr
n=
G/G=
G/A=
A/A=
A=
200
100
0
0
0.000
200
100
0
0
0.000
60
29
1
0
0.017
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE1 pubIA
99361959 GRCh37
98159960 NCBI36
  
GTAAGTTGCTTTCAGGGATCAGAGT C → T GTCTTTGAGACAAGCTTAACATTTC
- 
 
n=
C/C=
C/T=
T/T=
T=
192
60
32
4
0.208
192
32
43
21
0.443
60
28
2
0
0.033
20
2
6
2
0.500
14
3
4
0
0.286
Set-I
 PDEI
99361928 GRCh37
98159929 NCBI36
  
TGAGACAAGCTTAACATTTCTCCTC C → T ACTTCCTCTGCAGACCGTGAACGCC
- 
 
n=
C/C=
C/T=
T/T=
T=
192
96
0
0
0.000
192
95
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDEI
99361062 GRCh37
98159063 NCBI36
  
GTGGGGGTTTAGCTTAGCTCATCTA T → C GTGAAACTGGTTGAGAGTCACTCTT
- 
 
n=
T/T=
T/C=
C/C=
C=
200
100
0
0
0.000
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
6
1
0
0.071
Set-I
 PDEI
99361045 GRCh37
98159046 NCBI36
  
CTCATCTATGTGAAACTGGTTGAGA G → A TCACTCTTCTCTTGTGCCATCAGCT
- 
 
n=
G/G=
G/A=
A/A=
A=
200
100
0
0
0.000
200
100
0
0
0.000
60
29
1
0
0.017
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDEI
99361032 GRCh37
98159033 NCBI36
  
AACTGGTTGAGAGTCACTCTTCTCT T → C GTGCCATCAGCTCCTTGAAGAAGAT
- 
 
n=
T/T=
T/C=
C/C=
C=
200
100
0
0
0.000
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
99358546 GRCh37
98156547 NCBI36
  
GGTTAAGATGACTTTCCATGTTGTA T → C TGAAGACCTCACTGCCAATTTTCTT
- 
 
n=
T/T=
T/C=
C/C=
C=
200
100
0
0
0.000
200
100
0
0
0.000
60
28
2
0
0.033
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 16: CodingPDE2 pubsI
99358478 GRCh37
98156479 NCBI36
12561179
CTCTTCCAGTCTTCCCCAAAGGAAA C → T GAAGTCCAAATTAAAGTTTTGAATA
-393
Asn = Asn
n=
C/C=
C/T=
T/T=
T=
200
95
5
0
0.025
200
100
0
0
0.000
60
29
1
0
0.017
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 16: CodingPDE4 pubsI
99358401 GRCh37
98156402 NCBI36
13331256
CTTCCTGGAGAGATGGTGACACTTG G → C CCCAATGTCTCAAGTAAGTAGAAGG
-419
Gly → Ala
(D=60)
n=
G/G=
G/C=
C/C=
C=
200
79
19
2
0.115
200
90
10
0
0.050
60
25
5
0
0.083
20
8
2
0
0.100
14
7
0
0
0.000
Set-I
Exon 17: CodingPDE3 pubsI
99356612 GRCh37
98154613 NCBI36
14241347
CTTCTCCTGGATCACCAGTCACTGC T → C GTAACTGACGACTTCAAGCAGGGCC
-449
Ala = Ala
n=
T/T=
T/C=
C/C=
C=
200
83
9
8
0.125
200
83
10
7
0.120
60
25
3
2
0.117
20
6
1
3
0.350
14
3
3
1
0.357
Set-I
Exon 17: CodingPDE3 pubsI
99356611 GRCh37
98154612 NCBI36
14251348
TTCTCCTGGATCACCAGTCACTGCT G → A TAACTGACGACTTCAAGCAGGGCCA
-450
Val → Ile
(D=29)
n=
G/G=
G/A=
A/A=
A=
200
96
4
0
0.020
200
100
0
0
0.000
60
29
1
0
0.017
20
10
0
0
0.000
14
5
2
0
0.143
Set-I
Exon 17: CodingPDE2 pubsI
99356607 GRCh37
98154608 NCBI36
14291352
CCTGGATCACCAGTCACTGCTGTAA C → A TGACGACTTCAAGCAGGGCCAACGC
-451
Thr → Asn
(D=65)
n=
C/C=
C/A=
A/A=
A=
200
99
1
0
0.005
200
96
4
0
0.020
60
29
1
0
0.017
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
99354838 GRCh37
98152839 NCBI36
  
AAAGACTGAAATATTCATCTGAACT C → A ATTCTAATGAATATTATTTTGAAAA
- 
 
n=
C/C=
C/A=
A/A=
A=
198
79
19
1
0.106
200
90
10
0
0.050
60
25
4
1
0.100
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
Exon 18: CodingPDE2 pubsI
99354754 GRCh37
98152755 NCBI36
15231446
AGGATGGTCTTAACCAGAAGCCAGA A → G AAAGGGGAAAATGGAATCAGGTATG
-482
Glu = Glu
n=
A/A=
A/G=
G/G=
G=
200
97
3
0
0.015
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
99354731 GRCh37
98152732 NCBI36
  
GAAAAAGGGGAAAATGGAATCAGGT A → G TGTATATTTCTTTAAAATTTAAGTT
- 
 
n=
A/A=
A/G=
G/G=
G=
200
99
1
0
0.005
200
95
5
0
0.025
60
30
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
 PDE
99354695 GRCh37
98152696 NCBI36
  
TTTAAAATTTAAGTTTTATCAGATT C → T TTATGAAAGTAATGCATACCCATAG
- 
 
n=
C/C=
C/T=
T/T=
T=
200
88
12
0
0.060
198
99
0
0
0.000
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 19: CodingPDE2 pubsIA
99340771 GRCh37
98138772 NCBI36
16041527
CAATGAGTGGGAAAGTTTATGCAAA C → T ATCAGCAGCTACAATGCCAGCACAT
-509
Asn = Asn
n=
C/C=
C/T=
T/T=
T=
200
69
26
5
0.180
198
91
7
1
0.045
56
28
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
 PDE
99340664 GRCh37
98138665 NCBI36
  
TCAAGAATTTTTCTTTAAAAAATGC A → G TTGAAATTTTTAATGCCAAGAATGT
- 
 
n=
A/A=
A/G=
G/G=
G=
200
98
2
0
0.010
198
99
0
0
0.000
56
28
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 20: CodingPDE1 pubI
99340576 GRCh37
98138577 NCBI36
16861609
CACAATAAGCTCAACAGAGATTCCG C → T CACAATGTCAACCTAATTTCAATAC
-537
Pro → Ser
(D=74)
n=
C/C=
C/T=
T/T=
T=
200
99
1
0
0.005
198
99
0
0
0.000
56
28
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 PDE1 pubI
99340490 GRCh37
98138491 NCBI36
  
TAGTCCAAAGGAAGGTTAGTAACTC G → A TTTCATTGTATCAGAAGATCTGCTC
- 
 
n=
G/G=
G/A=
A/A=
A=
200
100
0
0
0.000
198
99
0
0
0.000
56
23
4
1
0.107
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
99340014 GRCh37
98138015 NCBI36
  
TCGAACAGTTTTTATTTTAGAAGCT A → G TCTCAACTTCTTCTGCTTTTGCCTT
- 
 
n=
A/A=
A/G=
G/G=
G=
200
100
0
0
0.000
200
100
0
0
0.000
60
29
1
0
0.017
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
Exon 22: CodingPDE1 pubIA
99338531 GRCh37
98136532 NCBI36
19251848
CTCAGGCTCCTTCCAACATGAAGTC G → A GTGCTTCAGGCAGGATGGCTGCTGA
-616
Ser = Ser
n=
G/G=
G/A=
A/A=
A=
200
100
0
0
0.000
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.