UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:PEPT2
HGNC Symbol:SLC15A2
HGNC Description:solute carrier family 15 (oligopeptide transporter), member 2
HGNC ID:10921
Superfamily:SLC
Chromosome:Chr.3(+): 121613171-121663034 GRCh37
Location:3q13.33
OMIM:602339
OMIM Phenotype:None
Accessions:NM_021082.1
Nucleotide RefSeq:NM_021082
Protein RefSeq:NP_066568
Entrez:6565
Ensembl:ENSG00000163406
Isoforms:4
Evidence:Substrate In Vitro Evidence: The stable dipeptide glycylsarcosine was shown to be a substrate of PEPT2 when expressed in HeLa cells using the vaccinia virus expression system. PEPT2-mediated uptake of glycylsarcosine was inhibited by Gly-Phe, Ala-Gly-Pro, cyclacillin, cephadroxil, and cephalexin (Liu W, Liang R, Ramamoorthy S, Fei YJ, Ganapathy ME, Hediger MA, Ganapathy V, Leibach FH. Molecular cloning of PEPT 2, a new member of the H+/peptide cotransporter family, from human kidney. Biochim Biophys Acta 1235(2): 461-6, 1995). Using rat Pept2 cDNA clones expressed in LLC-PK1 cells, Terada et al. showed that rPept2 had higher affinity for aminocephalosporins (cephalexin, cefadroxil, cephradine) than did rPept1 (Terada T, Saito H, Mukai M, Inui K: Recognition of [pic]-lactam antibiotics by rat peptide transporters, PEPT1 and PEPT2, in LLC-PK1 cells. Am J Physiol 273:F706 F711, 1997). Studies using rabbit renal brush border membrane vesicles showed that the ACE inhibitors quinapril and enalapril inhibit glycylsarcosine uptake in these preparations; this effect is probably related to inhibition of Pept2 by these agents (Lin CJ, Akarawut W, Smith DE. Competitive inhibition of glycylsarcosine transport by enalapril in rabbit renal brush border membrane vesicles: Interaction of ACE inhibitors with high-affinity H+/peptide symporter. Pharm Res 16:609 615, 1999; Akarawut W, Lin CJ, Smith DE. Noncompetitive inhibition of glycylsarcosine transport by quinapril in rabbit renal brush border membrane vesicles: Effect of high-affinity peptide transporter. J Pharmacol Exp Ther 287:684 690, 1998). Substrate In Vivo Evidence: Two independent PEPT2-deficient mouse lines have been established. One of these lines showed almost complete loss of glycylsarcosine uptake activity in the choroid plexus (Shen H, Smith DE, Keep RF, Xiang J, Brosius FC. Targeted disruption of the PEPT2 gene markedly reduces dipeptide uptake in choroid plexus. J Biol Chem 278:4786-4791, 2003). The other showed decreased renal reabsorption of two model dipeptides, D-alanyl-L-lysine-NE-7-amino-4-methylcoumarin-3-acetic acid (D-Ala-Lys-AMCA) and D-[3H]Phe-Ala (Rubio-Aliaga I, Frey I, Boll M, Groneberg DA, Eichinger HM, Balling R, Daniel H. Targeted disruption of the peptide transporter Pept2 gene in mice defines its physiological role in the kidney. Mol Cell Biol 23:3247-3252, 2003). Tissue Distribution Evidence: Northern blot analysis failed to detect PEPT2 mRNA in kidney or small intestine. RT-PCR analysis showed PEPT2 expression in the kidney, but not in small intestine (Liu W, Liang R, Ramamoorthy S, Fei YJ, Ganapathy ME, Hediger MA, Ganapathy V, Leibach FH. Molecular cloning of PEPT 2, a new member of the H+/peptide cotransporter family, from human kidney. Biochim Biophys Acta 1235(2): 461-6, 1995).
Tissues:Kidney
Type:protein-coding
Sets:I,IV
PharmGKB ID:PA35812
HPRD ID:09088
Substrates:Glycylsarcosine
Trivial Names:PEPT2
Transcripts:NM_021082.3 [Chr.3(+): 121613171-121663034 GRCh37]
NM_001145998.1 [Chr.3(+): 121613171-121663034 GRCh37]
XM_005247722.1 [Chr.3(+): 121613287-121661671 GRCh37]
XM_005247723.1 [Chr.3(+): 121633772-121661671 GRCh37]
ENST00000295605 [Chr.3(+): 121613287-121660099 GRCh37]
ENST00000465060 [Chr.3(+): 121647139-121649796 GRCh37]
ENST00000469013 [Chr.3(+): 121614186-121634486 GRCh37]
ENST00000469422 [Chr.3(+): 121658038-121659829 GRCh37]
ENST00000489711 [Chr.3(+): 121612936-121662949 GRCh37]
ENST00000489886 [Chr.3(+): 121633772-121641977 GRCh37]
ENST00000489957 [Chr.3(+): 121646506-121647385 GRCh37]
Annotation History:View Events (18)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC15A2.

Variant Data

View all PMT variants for SLC15A2 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC15A2 RESEQUENCING  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC15A2 RESEQUENCING
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
PromoterPDEI
121613054 GRCh37
123095744 NCBI36
-117-270
AAAGATAATCTTTCTTAAACATAGA T → C TTTCTAATCAGTTCTCTAGCATTGT
+ 
 
n=
T/T=
T/C=
C/C=
C=
130
57
7
1
0.069
134
52
15
0
0.112
134
60
7
0
0.052
132
55
11
0
0.083
n/a
0.000
PMT-272
PromoterPDE
121613170 GRCh37
123095860 NCBI36
-1-154
AGCTTCCTGCTTTGCTCTGGATCAG G → C AAGCTATTGAAGCTGACACCCACAG
+ 
 
n=
G/G=
G/C=
C/C=
C=
130
65
0
0
0.000
134
66
1
0
0.007
134
67
0
0
0.000
132
66
0
0
0.000
n/a
0.000
PMT-272
Promoter
Exon 1: 5UTR
PDE
121613205 GRCh37
123095895 NCBI36
35-119
AAGCTGACACCCACAGAGTTAAACT C → G AGTTGCTGAAGCCACCAGCTCCCCC
+ 
 
n=
C/C=
C/G=
G/G=
G=
130
57
7
1
0.069
134
51
16
0
0.119
134
60
7
0
0.052
132
64
2
0
0.015
n/a
0.000
PMT-272
Exon 1: 5UTRPDE
121613230 GRCh37
123095920 NCBI36
60-94
CAGTTGCTGAAGCCACCAGCTCCCC C → T TCCCAGTCCTTCTTTTCAGAGTAGG
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
65
0
0
0.000
134
67
0
0
0.000
134
65
2
0
0.015
132
66
0
0
0.000
n/a
0.000
PMT-272
 PDE
121613441 GRCh37
123096131 NCBI36
  
GAAGCCATCTCCGGTGAGTCCTTAG A → G TTCAATCCTGCCTCTGAGAGGAATG
+ 
 
n=
A/A=
A/G=
G/G=
G=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
121615212 GRCh37
123097902 NCBI36
  
AGAAATCTAATTGTTGAAACAGGGA A → T AAACAGCTCATGCTTGAATCATTGC
+ 
 
n=
A/A=
A/T=
T/T=
T=
200
100
0
0
0.000
200
100
0
0
0.000
60
30
0
0
0.000
20
9
0
1
0.100
14
7
0
0
0.000
Set-I
 PDEIA
121631841 GRCh37
123114531 NCBI36
  
TACAGGTGCATTTAGTATCAACATG G → A TTGGCATTCTCACCTCTCCATTTCA
+ 
 
n=
G/G=
G/A=
A/A=
A=
196
72
23
3
0.148
198
44
46
9
0.323
60
20
7
3
0.217
20
6
2
2
0.300
14
0
5
2
0.643
Set-I
 PDE
121631993 GRCh37
123114683 NCBI36
  
GTAAGAATCCTGTTATTTTGTATTT T → G CAAGAATATAGAGCCAGCATTAATG
+ 
 
n=
T/T=
T/G=
G/G=
G=
198
98
1
0
0.005
198
92
7
0
0.035
60
27
3
0
0.050
20
6
3
1
0.250
14
7
0
0
0.000
Set-I
Exon 9: CodingPDEI
121641693 GRCh37
123124383 NCBI36
1005852
AGCGACAGCACTGGCTAGACTGGGC A → G GCTGAGAAATATCCAGTAAGTTGGA
+284
Ala = Ala
n=
A/A=
A/G=
G/G=
G=
196
28
50
20
0.459
196
23
48
27
0.520
60
12
14
4
0.367
20
3
0
7
0.700
14
0
4
3
0.714
Set-I
Exon 10: CodingPDE
121641914 GRCh37
123124604 NCBI36
1048895
GCAGCTCATTATGGATGTAAAGGCA C → T TGACCAGGGTACTATTCCTTTATAT
+299
Leu = Leu
n=
C/C=
C/T=
T/T=
T=
200
99
1
0
0.005
200
100
0
0
0.000
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
121642048 GRCh37
123124738 NCBI36
  
CTCTCACAGGAAAGGGATTTCTCAT T → A ACAGGATCTGTTTGCCCTAGGGTTC
+ 
 
n=
T/T=
T/A=
A/A=
A=
200
28
51
21
0.465
200
23
50
27
0.520
58
12
13
4
0.362
20
3
0
7
0.700
14
0
4
3
0.714
Set-I
 PDE
121643170 GRCh37
123125860 NCBI36
  
TTTTTTTTCTTTTCTTCAGACATCA A → T CTAAATTAATTTGTTAAAATGTTTC
+ 
 
n=
A/A=
A/T=
T/T=
T=
200
20
53
27
0.535
198
26
49
24
0.490
60
4
15
11
0.617
20
7
0
3
0.300
14
3
4
0
0.286
Set-I
 PDE
121643299 GRCh37
123125989 NCBI36
  
ATCTATGCCTCCACCTGCAGTATTA C → A GATTAACAACCATAATTTGATGCTT
+ 
 
n=
C/C=
C/A=
A/A=
A=
200
100
0
0
0.000
198
99
0
0
0.000
60
29
1
0
0.017
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDEA
121643303 GRCh37
123125993 NCBI36
  
ATGCCTCCACCTGCAGTATTACGAT T → A AACAACCATAATTTGATGCTTTTCT
+ 
 
n=
T/T=
T/A=
A/A=
A=
200
20
53
27
0.535
198
27
49
23
0.480
60
4
15
11
0.617
20
7
0
3
0.300
14
3
4
0
0.286
Set-I
 PDEA
121643337 GRCh37
123126027 NCBI36
  
TAATTTGATGCTTTTCTCCTTGTAC G → A CTGATAAGGGCCAAGCTTCGACATG
+ 
 
n=
G/G=
G/A=
A/A=
A=
200
20
53
27
0.535
198
27
49
23
0.480
60
4
15
11
0.617
20
7
0
3
0.300
14
3
4
0
0.286
Set-I
 PDE
121643752 GRCh37
123126442 NCBI36
  
GTGCAGTGCTCACACTCATGATAGG A → G GAATATTTGTAGCTAATCCTTTTTA
+ 
 
n=
A/A=
A/G=
G/G=
G=
200
91
9
0
0.045
198
97
2
0
0.010
50
25
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
Exon 13: CodingPDE2 pubsI
121643804 GRCh37
123126494 NCBI36
12011048
CATGGTGTTACAGGTTCTAAATCCC T → C TTCTGGTTCTTATCTTCATCCCGTT
PEPT2*1 (350L-409P-509R) showed lower Km for glycyl-sarcosine compared to PEPT2*2 (350F-409S-509K) in transfected cells. PMID: 19940846.
+350
Phe → Leu
(D=22)
n=
T/T=
T/C=
C/C=
C=
200
24
57
19
0.475
198
16
62
21
0.525
56
11
13
4
0.375
20
3
1
6
0.650
14
0
4
3
0.714
Set-I
 PDEI
121643893 GRCh37
123126583 NCBI36
  
GAATTAACTTCTCGTAAGTGTTCAC C → T ATGTCTGTATGGATTACTCTAAATT
+ 
 
n=
C/C=
C/T=
T/T=
T=
200
24
56
20
0.480
196
17
60
21
0.520
56
11
13
4
0.375
20
3
1
6
0.650
14
0
4
3
0.714
Set-I
Exon 14: CodingPDE1 pubI
121646641 GRCh37
123129331 NCBI36
13141161
AAATGGCTGTTGGTATGATCCTAGC G → A TGCCTGGCATTTGCAGTTGCGGCAG
+387
Ala = Ala
n=
G/G=
G/A=
A/A=
A=
196
21
55
22
0.505
194
23
50
24
0.505
60
11
15
4
0.383
20
3
0
7
0.700
14
0
4
3
0.714
Set-I
Exon 15: CodingPDE4 pubsI
121647286 GRCh37
123129976 NCBI36
13781225
CTCTAAGGAAATGGCCCCAGCCCAG T → C CAGGTCCCCAGGAGGTTTTCCTACA
PEPT2*1 (350L-409P-509R) showed lower Km for glycyl-sarcosine compared to PEPT2*2 (350F-409S-509K) in transfected cells. PMID: 19940846.
+409
Ser → Pro
(D=74)
n=
T/T=
T/C=
C/C=
C=
198
27
52
20
0.465
198
23
51
25
0.510
60
12
14
4
0.367
20
3
0
7
0.700
14
0
4
3
0.714
Set-I
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 16: CodingPDE
121647923 GRCh37
123130613 NCBI36
15891436
CACAATTTGTCTCTCTACACTGAGC A → C TTCTGTGCAGGAGAAGAACTGGTAC
+479
His → Pro
(D=77)
n=
A/A=
A/C=
C/C=
C=
200
100
0
0
0.000
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 16: CodingPDE
121647930 GRCh37
123130620 NCBI36
15961443
TGTCTCTCTACACTGAGCATTCTGT G → T CAGGAGAAGAACTGGTACAGTCTTG
+481
Val = Val
n=
G/G=
G/T=
T/T=
T=
200
98
2
0
0.010
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
121648140 GRCh37
123130830 NCBI36
  
AGCTGTTACTGATTTTTACTTTCCT C → T TGTTGTAGGTAAAGGATACAGAAAG
+ 
 
n=
C/C=
C/T=
T/T=
T=
196
98
0
0
0.000
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 17: CodingPDE1 pubI
121648168 GRCh37
123130858 NCBI36
16791526
TTGTAGGTAAAGGATACAGAAAGCA A → G AACAACCAATGGGATGACAACCGTG
PEPT2*1 (350L-409P-509R) showed lower Km for glycyl-sarcosine compared to PEPT2*2 (350F-409S-509K) in transfected cells. PMID: 19940846.
+509
Lys → Arg
(D=26)
n=
A/A=
A/G=
G/G=
G=
196
27
51
20
0.464
200
23
50
27
0.520
60
13
12
5
0.367
20
3
0
7
0.700
14
0
4
3
0.714
Set-I
 PDE
121648234 GRCh37
123130924 NCBI36
  
TGAGATTCCAGGCCACTCTGTTTTC T → C TGAATCTTGGATCTCTTCTAATCTT
+ 
 
n=
T/T=
T/C=
C/C=
C=
196
96
2
0
0.010
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
121650611 GRCh37
123133301 NCBI36
  
AGTAGCTCACAGCCACCTCTTTACC C → A TCTCTCCATATACATATATCTCCTG
+ 
 
n=
C/C=
C/A=
A/A=
A=
200
100
0
0
0.000
200
100
0
0
0.000
60
29
1
0
0.017
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
121650623 GRCh37
123133313 NCBI36
  
CCACCTCTTTACCCTCTCTCCATAT A → C CATATATCTCCTGGGATCCTCTAGG
+ 
 
n=
A/A=
A/C=
C/C=
C=
200
100
0
0
0.000
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDEIA
121658376 GRCh37
123141066 NCBI36
  
TTGCAAATAGAAGGTAGAAATTGAG A → G CATTGCTTGAAGGACAATGAATTTT
+ 
 
n=
A/A=
A/G=
G/G=
G=
200
93
2
5
0.060
200
93
0
7
0.070
60
26
0
4
0.133
20
10
0
0
0.000
14
6
0
1
0.143
Set-I
 PDEI
121659197 GRCh37
123141887 NCBI36
  
CATGGGGCATGAGGGCAGTGAAGGG A → G GTTTGTTTACTTTCAAACTTGTGTC
+ 
 
n=
A/A=
A/G=
G/G=
G=
200
52
41
7
0.275
200
65
32
3
0.190
56
17
8
3
0.250
16
6
2
0
0.125
12
3
3
0
0.250
Set-I
 PDE
121659202 GRCh37
123141892 NCBI36
  
GGCATGAGGGCAGTGAAGGGAGTTT G → A TTTACTTTCAAACTTGTGTCATCCC
+ 
 
n=
G/G=
G/A=
A/A=
A=
200
100
0
0
0.000
200
94
6
0
0.030
56
27
1
0
0.018
16
8
0
0
0.000
12
6
0
0
0.000
Set-I
Exon 22: 3UTRPDEI
121659860 GRCh37
123142550 NCBI36
2349 
CCAAGAAGACAAAACTCTGATGACT T → C CCTAGATTCTGTCCTGACCCCAATT
+ 
 
n=
T/T=
T/C=
C/C=
C=
200
89
9
2
0.065
200
87
0
13
0.130
60
26
0
4
0.133
20
8
0
2
0.200
14
7
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.