UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:MCT1
HGNC Symbol:SLC16A1
HGNC Description:solute carrier family 16 (monocarboxylate transporter), member 1
HGNC ID:10922
Superfamily:SLC
Chromosome:Chr.1(-): 113454469-113498975 GRCh37
Location:1p12
OMIM:600682
OMIM Phenotype:None
Accessions:NM_003051
Nucleotide RefSeq:NM_003051
Protein RefSeq:NP_003042
Entrez:6566
Ensembl:ENSG00000155380
Isoforms:3
Evidence:Substrate In Vitro Evidence: The human MCT1 transporter has not been characterized in heterologous expression systems, but MCT1 activity has been studied using erythrocytes, which transport acetate, propionate, pyruvate, lactate, acetoacetate, and D-(-hydroxybutyrate with the properties of MCT transporters (Deuticke B. Monocarboxylate transport in erythrocytes. J Membr Biol 70:89-103, 1982). When expressed in X. laevis oocytes, rat MCT1 transported lactate, pyruvate, acetoacetate, D-(-hydroxybutyrate, ?-oxoisohexanoate and ?-oxoisovalerate, as measured by the two-electrode voltage clamp technique with change in intracellular pH as the index of transport activity (Bröer S, Schneider HP, Bröer A, Rahman B, Hamprecht B, Deitmer JW. Biochem J 333:167-174, 1998). Substrate In Vivo Evidence: A defect in the efflux of lactate from muscle has been suggested as a cause of cryptic exercise intolerance, and mutations in the MCT1 gene have been identified in patients with this disease; however, a causal relationship between MCT1 mutations and cryptic exercise intolerance has not been established (reviewed in: Halestrap AP, Meredith D. The SLC16 gene family-from monocarboxylate transporters (MCTs) to aromatic amino acid transporters and beyond. Pflugers Arch, May 9, 2003 [Epub ahead of print]). Tissue Distribution Evidence: MCT1 expression was detected in erythrocytes, cardiac muscle, intestine, skeletal muscle, sperm, and liver (low) (Garcia CK, Goldstein JL, Pathak RK, Anderson RG, Brown MS. Molecular characterization of a membrane transporter for lactate, pyruvate, and other monocarboxylates: implications for the Cori cycle. Cell 76(5):865-73, 1994).
Tissues:Erythrocytes, cardiac muscle, intestine, skeletal muscle, sperm; liver (low)
Type:protein-coding
Sets:IV
PharmGKB ID:PA35813
HPRD ID:02816
Substrates:Acetate, propionate, pyruvate, lactate, acetoacetate, D-b-hydroxybutyrate
Trivial Names:MCT, HHF7, MCT1
Transcripts:NM_003051.3 [Chr.1(-): 113454469-113498975 GRCh37]
NM_001166496.1 [Chr.1(-): 113454469-113498685 GRCh37]
XM_005271150.1 [Chr.1(-): 113454469-113498817 GRCh37]
ENST00000369626 [Chr.1(-): 113454469-113498975 GRCh37]
ENST00000429288 [Chr.1(-): 113460382-113499635 GRCh37]
ENST00000433570 [Chr.1(-): 113458828-113498616 GRCh37]
ENST00000443580 [Chr.1(-): 113460138-113478610 GRCh37]
ENST00000458229 [Chr.1(-): 113456647-113498685 GRCh37]
ENST00000478835 [Chr.1(-): 113471670-113498803 GRCh37]
ENST00000481750 [Chr.1(-): 113460640-113465014 GRCh37]
ENST00000538576 [Chr.1(-): 113454474-113498685 GRCh37]
Annotation History:View Events (11)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC16A1.

Variant Data

View all PMT variants for SLC16A1 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC16A1 RESEQUENCING  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC16A1 RESEQUENCING
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
PromoterPDE
113499150 GRCh37
113300673 NCBI36
-175-27220
TCTGGCAGAAACTGAGGGGTGAGAC C → T GATGGTTGTGTCCCGAACGAGGGCA
- 
 
n=
C/C=
C/T=
T/T=
T=
126
62
1
0
0.008
132
66
0
0
0.000
128
64
0
0
0.000
128
63
1
0
0.008
PMT-272
PromoterPDE
113499092 GRCh37
113300615 NCBI36
-117-27162
TAGAGCTCGTCAGACAGGGACCCAA G → A GGCGAGTCTGGCAGGGCGTGGTAGC
- 
 
n=
G/G=
G/A=
A/A=
A=
126
63
0
0
0.000
132
65
1
0
0.008
128
64
0
0
0.000
128
63
1
0
0.008
PMT-272
PromoterPDE
113499088 GRCh37
113300611 NCBI36
-113-27158
GCTCGTCAGACAGGGACCCAAGGGC G → A AGTCTGGCAGGGCGTGGTAGCTCCG
- 
 
n=
G/G=
G/A=
A/A=
A=
126
62
1
0
0.008
132
66
0
0
0.000
128
64
0
0
0.000
128
64
0
0
0.000
PMT-272
PromoterPDE1 pub
113499075 GRCh37
113300598 NCBI36
-100-27145
GGACCCAAGGGCGAGTCTGGCAGGG C → G GTGGTAGCTCCGCGCCGCTCAGCAG
- 
 
n=
C/C=
C/G=
G/G=
G=
126
63
0
0
0.000
132
66
0
0
0.000
128
52
12
0
0.094
128
64
0
0
0.000
PMT-272
Promoter
113498977 GRCh37
113300500 NCBI36
-2-27047
GGGGGCGCCGGCGCGCGCGGGCGAG CT → - AGAGGGCGCGCGCGGCTGAAAGCG
- 
 
n=
CT/CT=
CT/-=
-/-=
-=
126
62
1
0
0.008
132
66
0
0
0.000
128
64
0
0
0.000
128
64
0
0
0.000
PMT-272
Exon 1: 5UTR
113498897 GRCh37
113300420 NCBI36
79-26967
CTGTGTGGCGGGGAGGGGGCGGCGG C → CGGCGGC CGGGAGAGACGACTCCGCCCCCTGC
- 
 
n=
C/C=
C/CGGCGGC=
CGGCGGC/CGGCGGC=
CGGCGGC=
124
51
11
0
0.089
132
66
0
0
0.000
128
64
0
0
0.000
128
62
2
0
0.016
PMT-272
Exon 1: 5UTRPDE
113498872 GRCh37
113300395 NCBI36
104-26942
CCGGGAGAGACGACTCCGCCCCCTG C → A GCGCATGCTCCGGCCCCGGCGGGTT
- 
 
n=
C/C=
C/A=
A/A=
A=
102
50
1
0
0.010
132
66
0
0
0.000
128
64
0
0
0.000
124
62
0
0
0.000
PMT-272
Exon 1: 5UTRPDE
113498861 GRCh37
113300384 NCBI36
115-26931
GACTCCGCCCCCTGCGCGCATGCTC C → G GGCCCCGGCGGGTTATAAGGCAGCC
- 
 
n=
C/C=
C/G=
G/G=
G=
102
48
3
0
0.029
132
66
0
0
0.000
128
64
0
0
0.000
124
61
1
0
0.008
PMT-272
Exon 1: 5UTR
113498855 GRCh37
113300378 NCBI36
121-26925
GCCCCCTGCGCGCATGCTCCGGCCC C → CC GGCGGGTTATAAGGCAGCCTCGCTG
- 
 
n=
C/C=
C/CC=
CC/CC=
CC=
102
50
1
0
0.010
132
66
0
0
0.000
128
64
0
0
0.000
124
62
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.