UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:NAPI1
HGNC Symbol:SLC17A1
HGNC Description:solute carrier family 17 (organic anion transporter), member 1
HGNC ID:10929
Superfamily:SLC
Chromosome:Chr.6(-): 25783125-25832287 GRCh37
Location:6p22.2
OMIM:182308
OMIM Phenotype:None
Accessions:NM_005074
Nucleotide RefSeq:NM_005074
Protein RefSeq:NP_005065
Entrez:6568
Ensembl:ENSG00000124568
Isoforms:3
Evidence:Substrate In Vitro Evidence: 1. NPT-1 RNA injected into Xenopus oocytes resulted in Na+/Pi co-transport activity showing a high affinity for phosphate (Km 0.29 mM). Miyamoto, K et al. Biochem J. 1995 Jan 1, 305 (pt 1):81-5 PMID 7826357. 2. Mouse Npt1 RNA was injected into xenopus oocytes. Faropenem (an oral penem antibiotic) was transported (Km 0.77 mM) in an Na+ independent, Cl- dependent manner. Transport was significantly inhibited by benzylpenicillin, ampicillin, cephalexin, cefazolin (beta-lactam antibiotics), as well as indomethacin and furosemide. May play a role in the renal secretion of penem antibiotics. Uchino, H et al. Antimicrob Agents Chemother 2000 Mar, 44(3):574-7 PMID 10681320. Tissue Distribution Evidence: 3. Northern blotting demonstrated that NPT-1 mRNA is expressed in renal cortex, liver, and brain. Miyamoto, K et al. Biochem J. 1995 Jan 1, 305 (pt 1):81-5 PMID 7826357.
Tissues:renal cortex, liver, brain
Type:protein-coding
Sets:V
PharmGKB ID:PA35820
HPRD ID:01661
Substrates:sodium, phosphate, antibiotics
Trivial Names:NPT1, NPT-1, NAPI-1
Transcripts:NM_005074.3 [Chr.6(-): 25783125-25832287 GRCh37]
XM_005249306.1 [Chr.6(-): 25783143-25832069 GRCh37]
XM_005249307.1 [Chr.6(-): 25798824-25832069 GRCh37]
ENST00000244527 [Chr.6(-): 25783125-25832287 GRCh37]
ENST00000377886 [Chr.6(-): 25783354-25832224 GRCh37]
ENST00000427328 [Chr.6(-): 25783128-25832287 GRCh37]
ENST00000468082 [Chr.6(-): 25799013-25830785 GRCh37]
ENST00000476801 [Chr.6(-): 25798811-25832269 GRCh37]
Annotation History:View Events (19)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC17A1.

Variant Data

View all PMT variants for SLC17A1 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC17A1 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC17A1 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
25831284 GRCh37
25939263 NCBI36
 -499
GTAAAACAAATTCCTTTTTTCCCCC T → - GTATCTTAATAGAGCTGGAAGATAC
+ 
 
n=
T/T=
T/-=
-/-=
-=
126
61
2
0
0.016
112
56
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
 PDE
25831264 GRCh37
25939243 NCBI36
 -479
CAGAAAAGGAGTAAGCAAAGGTAAA A → G CAAATTCCTTTTTTCCCCCTGTATC
+ 
 
n=
A/A=
A/G=
G/G=
G=
126
62
1
0
0.008
112
56
0
0
0.000
136
68
0
0
0.000
134
66
1
0
0.007
PMT-272
 PDEI
25831212 GRCh37
25939191 NCBI36
 -427
GGAGATTGCTATAGGTCAGAAACTC G → A GCAGTATGAAAAGAAAGGAAGAATG
+ 
 
n=
G/G=
G/A=
A/A=
A=
126
36
24
3
0.238
112
32
21
3
0.241
136
8
23
37
0.713
134
20
28
19
0.493
PMT-272
 PDE
25831076 GRCh37
25939055 NCBI36
 -291
AGAGAACAAACAAATAACCCTGCCA A → G TCCAGAATTCTAAATCCGTGATAAT
+ 
 
n=
A/A=
A/G=
G/G=
G=
126
57
6
0
0.048
112
44
10
2
0.125
136
66
2
0
0.015
134
58
9
0
0.067
PMT-272
 PDE
25831016 GRCh37
25938995 NCBI36
 -231
TTATTTTACTTTTGTGATTGTTTTG G → A TTGATTAAAAATATATGGAAGACCT
+ 
 
n=
G/G=
G/A=
A/A=
A=
126
62
1
0
0.008
114
57
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
Exon 2: 5UTRPDE
25830790 GRCh37
25938769 NCBI36
112-5
CAACCGGTTATCCATTTGCATACAC G → A GCTGAAGTTGCTTCTCTTCTTGCTG
+ 
 
n=
G/G=
G/A=
A/A=
A=
118
58
1
0
0.008
94
47
0
0
0.000
134
67
0
0
0.000
132
66
0
0
0.000
PMT-272

Transmembrane prediction: TOPO2 image is not available.