UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:NPT3
HGNC Symbol:SLC17A2
HGNC Description:solute carrier family 17, member 2
HGNC ID:10930
Superfamily:SLC
Chromosome:Chr.6(-): 25912982-25930954 GRCh37
Location:6p21.3
OMIM:611049
OMIM Phenotype:None
Accessions:U90544
Nucleotide RefSeq:NM_005835
Protein RefSeq:NP_005826
Entrez:10246
Ensembl:ENSG00000112337
Isoforms:5
Evidence:None
Tissues:None
Type:protein-coding
Sets:0
PharmGKB ID:PA35821
HPRD ID:10232
Substrates:None
Trivial Names:NPT3
Transcripts:NM_005835.2 [Chr.6(-): 25912982-25930946 GRCh37]
XM_005248784.1 [Chr.6(-): 25913522-25930954 GRCh37]
XM_005248786.1 [Chr.6(-): 25913522-25930899 GRCh37]
XM_005248783.1 [Chr.6(-): 25913522-25930899 GRCh37]
XM_005248785.1 [Chr.6(-): 25913614-25930899 GRCh37]
ENST00000265425 [Chr.6(-): 25913545-25926045 GRCh37]
ENST00000360488 [Chr.6(-): 25912982-25930839 GRCh37]
ENST00000377850 [Chr.6(-): 25912982-25930946 GRCh37]
Annotation History:View Events (36)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC17A2.

Variant Data

View all PMT variants for SLC17A2 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC17A2 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC17A2 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
25931197 GRCh37
26039176 NCBI36
-251-5173
GGACAAGTCACTGAACCTCTTTGAA T → C TGGCTTCCGCTTTAGTAAAGCAAGG
+ 
 
n=
T/T=
T/C=
C/C=
C=
132
65
1
0
0.008
118
59
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
PromoterPDE
25931152 GRCh37
26039131 NCBI36
-206-5128
ATGGAGTCAGACCCATATTCACTTC C → G TAGTGTTTTCCCTGAGCTTGGACAA
+ 
 
n=
C/C=
C/G=
G/G=
G=
132
66
0
0
0.000
124
62
0
0
0.000
136
67
1
0
0.007
134
67
0
0
0.000
PMT-272
PromoterPDE
25931140 GRCh37
26039119 NCBI36
-194-5116
CTGAAATCAGTGATGGAGTCAGACC C → T ATATTCACTTCCTAGTGTTTTCCCT
+ 
 
n=
C/C=
C/T=
T/T=
T=
132
66
0
0
0.000
126
63
0
0
0.000
136
68
0
0
0.000
134
66
1
0
0.007
PMT-272
PromoterPDE
25931020 GRCh37
26038999 NCBI36
-74-4996
AGAGTATCTCAAAAGATGTCATCGT G → A TGTTTCTGCTTTGAACTGTGCATAC
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
57
9
0
0.068
126
47
14
2
0.143
136
64
4
0
0.029
134
59
8
0
0.060
PMT-272

Transmembrane prediction: TOPO2 image is not available.