UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:NPT4
HGNC Symbol:SLC17A3
HGNC Description:solute carrier family 17 (organic anion transporter), member 3
HGNC ID:10931
Superfamily:SLC
Chromosome:Chr.6(-): 25845328-25874471 GRCh37
Location:6p21.3
OMIM:611034
OMIM Phenotype:None
Accessions:U90545
Nucleotide RefSeq:NM_001098486
Protein RefSeq:NP_001091956
Entrez:10786
Ensembl:ENSG00000124564
Isoforms:3
Evidence:None
Tissues:None
Type:protein-coding
Sets:0
PharmGKB ID:PA35822
HPRD ID:10233
Substrates:None
Trivial Names:NPT4
Transcripts:NM_001098486.1 [Chr.6(-): 25845328-25874471 GRCh37]
NM_006632.3 [Chr.6(-): 25845328-25874471 GRCh37]
XM_005248819.1 [Chr.6(-): 25845331-25874463 GRCh37]
ENST00000308453 [Chr.6(-): 25850753-25868688 GRCh37]
ENST00000360657 [Chr.6(-): 25845328-25882514 GRCh37]
ENST00000361703 [Chr.6(-): 25845328-25874440 GRCh37]
ENST00000397060 [Chr.6(-): 25845084-25874471 GRCh37]
ENST00000449356 [Chr.6(-): 25851001-25868683 GRCh37]
ENST00000481949 [Chr.6(-): 25833294-25850105 GRCh37]
ENST00000503922 [Chr.6(-): 25850406-25874466 GRCh37]
ENST00000505420 [Chr.6(-): 25841533-25849622 GRCh37]
ENST00000506105 [Chr.6(-): 25850141-25874463 GRCh37]
ENST00000509714 [Chr.6(-): 25850042-25868717 GRCh37]
Annotation History:View Events (11)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC17A3.

Variant Data

View all PMT variants for SLC17A3 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC17A3 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC17A3 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
25874873 GRCh37
25982852 NCBI36
-402-6258
TTAATTGAAATTTTGTTAATTTTTT T → - CTTCTTTGAAATATGTGAATTGTAA
+ 
 
n=
T/T=
T/-=
-/-=
-=
132
64
2
0
0.015
134
67
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
 PDEI
25874823 GRCh37
25982802 NCBI36
-352-6208
AGAGTTCAGTATTTTTGTGTTTTTT C → A CTTTGCTATTTTTGATTTTCCCCCT
+ 
 
n=
C/C=
C/A=
A/A=
A=
132
43
22
1
0.182
134
27
33
7
0.351
136
53
14
1
0.118
136
37
21
10
0.301
PMT-272
 PDE
25874782 GRCh37
25982761 NCBI36
-311-6167
GTCTTTTTTGAAAAGGTTAAAAAGA G → C ATAAATTATAATTAAAGAGTTCAGT
+ 
 
n=
G/G=
G/C=
C/C=
C=
132
65
1
0
0.008
134
67
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
 PDE
25874762 GRCh37
25982741 NCBI36
-291-6147
TGGTGTCTTCAATGTCTTTAGTCTT T → C TTTGAAAAGGTTAAAAAGAGATAAA
+ 
 
n=
T/T=
T/C=
C/C=
C=
132
66
0
0
0.000
134
66
1
0
0.007
136
68
0
0
0.000
136
67
1
0
0.007
PMT-272
PromoterPDE
25874607 GRCh37
25982586 NCBI36
-136-5992
GAAGCATTCGGAAATCCAGCCCAAT C → G CCCTCTGCAGTTCTTTCTGCTTTTT
+ 
 
n=
C/C=
C/G=
G/G=
G=
132
65
1
0
0.008
134
67
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
PromoterPDE
25874574 GRCh37
25982553 NCBI36
-103-5959
CTCAGAAGGGCTTCTTGCCAAATAG G → A CTTTGAAGAAGCATTCGGAAATCCA
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
66
0
0
0.000
134
66
0
1
0.015
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
PromoterPDE
25874499 GRCh37
25982478 NCBI36
-28-5884
AGAGATGAGGATTCTTTGCCACCCT A → G GGGCTTAAGTTGCTAATCATTAATA
+ 
 
n=
A/A=
A/G=
G/G=
G=
132
66
0
0
0.000
134
66
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
PromoterPDE
25874475 GRCh37
25982454 NCBI36
-4-5860
ACTCCCTTGGACTTTTTGGAGCAGA G → A AGATGAGGATTCTTTGCCACCCTAG
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
65
1
0
0.008
132
66
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 1: 5UTR
Promoter
PDE
25874431 GRCh37
25982410 NCBI36
41-5816
CTGTGGAAGGGCTTCAAGTTGAACC C → G AGCGTTTCCTCCAAGCTTACTCCCT
+ 
 
n=
C/C=
C/G=
G/G=
G=
132
66
0
0
0.000
126
63
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
PMT-272
Exon 1: 5UTR
Promoter
PDEI
25874423 GRCh37
25982402 NCBI36
49-5808
CTTAATGTCTGTGGAAGGGCTTCAA G → A TTGAACCCAGCGTTTCCTCCAAGCT
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
65
1
0
0.008
126
55
7
1
0.071
136
68
0
0
0.000
136
66
2
0
0.015
PMT-272

Transmembrane prediction: TOPO2 image is not available.