UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:KAIA2138
HGNC Symbol:SLC17A4
HGNC Description:solute carrier family 17, member 4
HGNC ID:10932
Superfamily:SLC
Chromosome:Chr.6(+): 25754927-25781403 GRCh37
Location:6p22.2
OMIM:604216
OMIM Phenotype:None
Accessions:AB020527
Nucleotide RefSeq:NM_005495
Protein RefSeq:NP_005486
Entrez:10050
Ensembl:ENSG00000146039
Isoforms:3
Evidence:None
Tissues:None
Type:protein-coding
Sets:0
PharmGKB ID:PA35823
HPRD ID:05022
Substrates:None
Trivial Names:KAIA2138
Transcripts:NM_005495.2 [Chr.6(+): 25754927-25781403 GRCh37]
XM_005248778.1 [Chr.6(+): 25754968-25780552 GRCh37]
XM_005248777.1 [Chr.6(+): 25754999-25780552 GRCh37]
ENST00000377905 [Chr.6(+): 25754927-25781419 GRCh37]
ENST00000397076 [Chr.6(+): 25762151-25779728 GRCh37]
ENST00000439485 [Chr.6(+): 25754968-25780198 GRCh37]
Annotation History:View Events (19)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC17A4.

Variant Data

View all PMT variants for SLC17A4 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC17A4 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC17A4 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
25755101 GRCh37
25863080 NCBI36
 -7090

G → A, C
CTGTTAGAGAGCAGCTTAATTTGCT G → A TTTAGGGGCAGAGATTGTGGGAGTG
CTGTTAGAGAGCAGCTTAATTTGCT G → C TTTAGGGGCAGAGATTGTGGGAGTG
+ 

 
 
 
n=
G/G=
G/A=
A/A=
G/C=
C/C=
A/C=
A=
C=
126
57
1
0
5
0
0
0.008
0.040
126
62
0
0
1
0
0
0.000
0.008
136
68
0
0
0
0
0
0.000
0.000
134
64
0
0
3
0
0
0.000
0.022
PMT-272

Transmembrane prediction: TOPO2 image is not available.