UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:VGLUT2
HGNC Symbol:SLC17A6
HGNC Description:solute carrier family 17 (vesicular glutamate transporter), member 6
HGNC ID:16703
Superfamily:SLC
Chromosome:Chr.11(+): 22359667-22401049 GRCh37
Location:11p14.3
OMIM:607563
OMIM Phenotype:None
Accessions:AB032435
Nucleotide RefSeq:NM_020346
Protein RefSeq:NP_065079
Entrez:57084
Ensembl:ENSG00000091664
Isoforms:1
Evidence:Substrate In Vitro Evidence: Inorganic phosphate in X. laevis oocytes Aihara et al 2000, Journal of Neurochemistry, Vol 74 (6), p.2662 Glutamate in intracellular vesicles from transiently transfected PC12 cells Varoqui et al 2002, J Neuroscience, Vol 22 (1), p. 142-55 Tissue Distribution Evidence: mRNA detected in several areas of the brain via Northern Blot Aihara et al 2000, Journal of Neurochemistry, Vol 74 (6), p.2662 VGUT2 (SLC17A6) is expressed in a complimentary fashion with VGLUT1 (SLC17A7). In general, VGLUT2 is expressed in sensory and autonomic pathways whereas is associated with neuronal pathways that exhibit activity-dependent potentiation. Detection was done via Western Blot. Varoqui et al 2002, J Neuroscience, Vol 22 (1), p. 142-55
Tissues:brain (neurons), endocrine
Type:protein-coding
Sets:II,IV
PharmGKB ID:PA424
HPRD ID:10459
Substrates:glutamate
Trivial Names:DNPI, VGLUT2
Transcripts:NM_020346.2 [Chr.11(+): 22359667-22401049 GRCh37]
ENST00000263160 [Chr.11(+): 22359643-22401049 GRCh37]
ENST00000534115 [Chr.11(+): 22364523-22382511 GRCh37]
Annotation History:View Events (2)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC17A6.

Variant Data

View all PMT variants for SLC17A6 on UCSC Genome Browser
Showing SNP features for transcript: NM_020346  
SLC17A6 RESEQUENCING  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC17A6 RESEQUENCING
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
PromoterPDE
22359500 GRCh37
22316076 NCBI36
-167-580
ACTTACGCTGGCGTGATGGGAGGAG A → T TCATGGGCAGAGAGGAAAAACTAAT
+ 
 
n=
A/A=
A/T=
T/T=
T=
132
62
4
0
0.030
136
68
0
0
0.000
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272
PromoterPDE
22359525 GRCh37
22316101 NCBI36
-142-555
ATCATGGGCAGAGAGGAAAAACTAA T → C AGCAGCATTGCTCACCTGAGACCTG
+ 
 
n=
T/T=
T/C=
C/C=
C=
132
63
3
0
0.023
136
68
0
0
0.000
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272
PromoterPDE
22359575 GRCh37
22316151 NCBI36
-92-505
GAGATGCTCCCATGAGTTTTGAATA T → C GCTCTGCTCCTTACAGCAAAGACAC
+ 
 
n=
T/T=
T/C=
C/C=
C=
132
66
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272
PromoterPDE
22359629 GRCh37
22316205 NCBI36
-38-451
TTTTAAAAGTACCATTCTTTTGACT T → A TGCTGTTCCCAAGGCTTCTGTGATA
+ 
 
n=
T/T=
T/A=
A/A=
A=
132
66
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
132
65
1
0
0.008
PMT-272
PromoterPDE
22359651 GRCh37
22316227 NCBI36
-16-429
ACTTTGCTGTTCCCAAGGCTTCTGT G → A ATATTCCGGCCCCTCCGTTTAAAAG
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
65
1
0
0.008
136
58
10
0
0.074
136
68
0
0
0.000
132
62
4
0
0.030
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.