UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:VGLUT1
HGNC Symbol:SLC17A7
HGNC Description:solute carrier family 17 (vesicular glutamate transporter), member 7
HGNC ID:16704
Superfamily:SLC
Chromosome:Chr.19(-): 49932655-49945617 GRCh37
Location:19q13
OMIM:605208
OMIM Phenotype:None
Accessions:AB032436
Nucleotide RefSeq:NM_020309
Protein RefSeq:NP_064705
Entrez:57030
Ensembl:ENSG00000104888
Isoforms:2
Evidence:Substrate In Vitro Evidence: Glutamate in synaptic vesicles Bellocchio et al 2000, Science, Vol 289 (5481), p.957-60 Inorganic phosphate in X. laevis oocytes Ni et al 1994, PNAS, Vol 91 (12), p. 5607-11 Tissue Distribution Evidence: Several areas of the brain via Northern Blot, in situ hybridization histochemistry Ni et al 1994, PNAS, Vol 91 (12), p. 5607-11 VGUT1 (SLC17A7) is expressed in a complimentary fashion with VGLUT2 (SLC17A6). In general, VGLUT1 is associated with neuronal pathways that exhibit activity-dependent potentiation whereas VGLUT2 is expressed in sensory and autonomic pathways Detection was done via Western Blot. Varoqui et al 2002, J Neuroscience, Vol 22 (1), p. 142-55
Tissues:brain (neurons), endocrine
Type:protein-coding
Sets:II,IV
PharmGKB ID:PA423
HPRD ID:05551
Substrates:glutamate
Trivial Names:BNPI, VGLUT1
Transcripts:NM_020309.3 [Chr.19(-): 49932655-49944808 GRCh37]
XM_005259088.1 [Chr.19(-): 49932655-49945617 GRCh37]
ENST00000221485 [Chr.19(-): 49932658-49944808 GRCh37]
ENST00000543531 [Chr.19(-): 49933243-49945617 GRCh37]
ENST00000596689 [Chr.19(-): 49935879-49937918 GRCh37]
ENST00000598018 [Chr.19(-): 49936516-49941571 GRCh37]
ENST00000600601 [Chr.19(-): 49933243-49945617 GRCh37]
ENST00000600672 [Chr.19(-): 49934012-49939437 GRCh37]
Annotation History:View Events (11)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC17A7.

Variant Data

View all PMT variants for SLC17A7 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC17A7 RESEQUENCING  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC17A7 RESEQUENCING
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 PDE
49946079 GRCh37
54637891 NCBI36
-1271-1443
ACAGATCCCATGGGGCCGGGGCAAG A → G CTGGGAGGGTAGGGAGAGATCCAGG
- 
 
n=
A/A=
A/G=
G/G=
G=
136
68
0
0
0.000
134
67
0
0
0.000
110
55
0
0
0.000
130
64
1
0
0.008
n/a
0.000
PMT-272
 PDE
49936905 GRCh37
54628717 NCBI36
  
CCTGCACAGCGTGTAGATCAGGGAC G → A GTTCCTGCAGACTCTAGAGGAGACG
- 
 
n=
G/G=
G/A=
A/A=
A=
160
79
1
0
0.006
158
79
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
49936272 GRCh37
54628084 NCBI36
  
TACACTGTGGTCCCTGAAGGGACGC G → A GAGAAGCCCTCAGCCCCGCTCCCCG
- 
 
n=
G/G=
G/A=
A/A=
A=
158
78
1
0
0.006
160
80
0
0
0.000
118
59
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
49936036 GRCh37
54627848 NCBI36
  
CCCAGGAGGAGAGGGCAGGGGGGCG C → T GGAGGGGTCGGCGGGAGGGAACTGG
- 
 
n=
C/C=
C/T=
T/T=
T=
158
77
2
0
0.013
160
80
0
0
0.000
118
59
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
49935990 GRCh37
54627802 NCBI36
  
ACTGGCGGCGATCCCGAGGCAGGGA G → A GAGCCGGTGGTGCACGGACCGGGCA
- 
 
n=
G/G=
G/A=
A/A=
A=
158
78
1
0
0.006
160
80
0
0
0.000
118
59
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
49934263 GRCh37
54626075 NCBI36
  
CCATGACTAAGCACAAGGTGGGTGC C → T GCAGTCCTGACTCAGTCTGCCTCCA
- 
 
n=
C/C=
C/T=
T/T=
T=
160
78
2
0
0.013
156
78
0
0
0.000
120
60
0
0
0.000
96
48
0
0
0.000
12
6
0
0
0.000
Set-II

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.