UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:VGLUT3
HGNC Symbol:SLC17A8
HGNC Description:solute carrier family 17 (vesicular glutamate transporter), member 8
HGNC ID:20151
Superfamily:SLC
Chromosome:Chr.12(+): 100750857-100815837 GRCh37
Location:12q23.1
OMIM:607557
OMIM Phenotype:None
Accessions:NM_139319.1
Nucleotide RefSeq:NM_139319
Protein RefSeq:NP_647480
Entrez:246213
Ensembl:ENSG00000179520
Isoforms:2
Evidence:Substrate In Vitro Evidence: Glutamate in membrane vesicles when heterologously expressed in neuroendocrine cell line Takamori et al 2002, EMBO Rep., Vol 3 (8), p. 798-803 Tissue Distribution Evidence: Expressed in the brain, overlaps some with VGLUT1 and VGLUT2 (which exhibit complimentary expression) Takamori et al 2002, EMBO Rep., Vol 3 (8), p. 798-803
Tissues:brain (neurons and glia), liver, kidney
Type:protein-coding
Sets:II,IV
PharmGKB ID:PA223010
HPRD ID:10457
Substrates:glutamate
Trivial Names:DFNA25, VGLUT3
Transcripts:NM_139319.2 [Chr.12(+): 100750857-100815837 GRCh37]
NM_001145288.1 [Chr.12(+): 100750857-100815837 GRCh37]
ENST00000323346 [Chr.12(+): 100750857-100815837 GRCh37]
ENST00000392989 [Chr.12(+): 100751146-100814030 GRCh37]
ENST00000547922 [Chr.12(+): 100796396-100798158 GRCh37]
ENST00000552697 [Chr.12(+): 100804399-100813867 GRCh37]
Annotation History:View Events (2)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC17A8.

Variant Data

View all PMT variants for SLC17A8 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC17A8 RESEQUENCING  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC17A8 RESEQUENCING
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 PDE
100750418 GRCh37
99274549 NCBI36
-439-752
GTGGCCTGGGTTTTGCATTTGGGCT A → G CTCAAATGCAAGTTCCTCGTGGGAC
+ 
 
n=
A/A=
A/G=
G/G=
G=
132
59
7
0
0.053
122
61
0
0
0.000
122
61
0
0
0.000
126
63
0
0
0.000
n/a
0.000
PMT-272
PromoterPDE
100750680 GRCh37
99274811 NCBI36
-177-490
TTACTATAGCATCACCTTGGAAAGT C → A TCACTTGGTGAGAGCGGCAGGCGAG
+ 
 
n=
C/C=
C/A=
A/A=
A=
132
65
1
0
0.008
122
61
0
0
0.000
122
61
0
0
0.000
126
63
0
0
0.000
n/a
0.000
PMT-272
PromoterPDE
100750723 GRCh37
99274854 NCBI36
-134-447
CAGGCGAGCTGGGGTGGGGCAGGAG G → C GGGACGCGGCTGGCTGGAGGGGCTG
+ 
 
n=
G/G=
G/C=
C/C=
C=
132
66
0
0
0.000
122
60
1
0
0.008
122
61
0
0
0.000
126
63
0
0
0.000
n/a
0.000
PMT-272
PromoterPDE
100750726 GRCh37
99274857 NCBI36
-131-444
GCGAGCTGGGGTGGGGCAGGAGGGG G → A ACGCGGCTGGCTGGAGGGGCTGGAG
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
65
1
0
0.008
122
61
0
0
0.000
122
61
0
0
0.000
126
63
0
0
0.000
n/a
0.000
PMT-272
Exon 1: 5UTRPDE
100750924 GRCh37
99275055 NCBI36
68-246
CGTGCAGCTTTTGCAAGGGACTGAA T → C TCCCAGCCAGACACCCCTTGGACTC
+ 
 
n=
T/T=
T/C=
C/C=
C=
132
66
0
0
0.000
122
61
0
0
0.000
122
60
1
0
0.008
126
63
0
0
0.000
n/a
0.000
PMT-272
Exon 1: 5UTRPDEI
100750952 GRCh37
99275083 NCBI36
96-218
CCAGCCAGACACCCCTTGGACTCTT T → C TTTGGAGGGGTGGGGAGCAGAGAGA
+ 
 
n=
T/T=
T/C=
C/C=
C=
132
49
16
1
0.136
122
36
23
2
0.221
122
59
2
0
0.016
126
46
15
2
0.151
n/a
0.000
PMT-272
Exon 1: 5UTRPDE
100750966 GRCh37
99275097 NCBI36
110-204
CTTGGACTCTTTTTTGGAGGGGTGG G → A GAGCAGAGAGAGGAGGGAGTTGTCT
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
64
2
0
0.015
122
61
0
0
0.000
122
61
0
0
0.000
126
63
0
0
0.000
n/a
0.000
PMT-272
Exon 1: CodingPDE
100751192 GRCh37
99275323 NCBI36
33623
AAAATGCCTTTTAAAGCATTTGATA C → T CTTCAAAGAAAAAATTCTGAAACCT
+8
Thr → Ile
(D=89)
n=
C/C=
C/T=
T/T=
T=
160
77
3
0
0.019
158
79
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 1: CodingPDE
100751223 GRCh37
99275354 NCBI36
36754
AAGAAAAAATTCTGAAACCTGGGAA G → A GAAGGAGTGAAGAACGCCGTGGGAG
+18
Lys = Lys
n=
G/G=
G/A=
A/A=
A=
160
73
7
0
0.044
158
79
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
100774437 GRCh37
99298568 NCBI36
  
GCTTAGTATACTTTCTTTTTCCTTT A → C ATCCTGGCTTTTATTTTCTGCCTAT
+ 
 
n=
A/A=
A/C=
C/C=
C=
158
76
3
0
0.019
158
76
3
0
0.019
120
60
0
0
0.000
98
48
1
0
0.010
12
6
0
0
0.000
Set-II
Exon 2: CodingPDE
100774548 GRCh37
99298679 NCBI36
484171
ATGAAGAAGGAAGGCCGGTGCAGAC G → A TCCAGGCCAAGCCCCCCACTCTGCG
+57
Thr = Thr
n=
G/G=
G/A=
A/A=
A=
158
79
0
0
0.000
158
79
0
0
0.000
120
41
18
1
0.167
98
49
0
0
0.000
12
3
3
0
0.250
Set-II
Exon 2: CodingPDE
100774562 GRCh37
99298693 NCBI36
498185
CCGGTGCAGACGTCCAGGCCAAGCC C → T CCCACTCTGCGACTGCCACTGCTGC
+62
Pro → Leu
(D=98)
n=
C/C=
C/T=
T/T=
T=
158
78
1
0
0.006
158
79
0
0
0.000
120
60
0
0
0.000
98
49
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 2: CodingPDE
100774713 GRCh37
99298844 NCBI36
649336
TCAACAATAGCACCGTATATGTTGA T → C GGAAAACCGGAAATTCAGGTTGGTA
+112
Asp = Asp
n=
T/T=
T/C=
C/C=
C=
158
79
0
0
0.000
158
78
1
0
0.006
120
60
0
0
0.000
98
49
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
100774780 GRCh37
99298911 NCBI36
  
GACTTTTCTTTTTGAGACAGGGTCT C → T GCTCGGTCTCCCAGGCTAGAGTACA
+ 
 
n=
C/C=
C/T=
T/T=
T=
158
79
0
0
0.000
158
78
1
0
0.006
120
60
0
0
0.000
98
49
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
100784664 GRCh37
99308795 NCBI36
  
AAGATGCCCTCCATAAGTATGTGTT A → C AATAAATGAAAAAAGAAAGACCTCA
+ 
 
n=
A/A=
A/C=
C/C=
C=
160
80
0
0
0.000
160
78
2
0
0.013
118
59
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
100784691 GRCh37
99308822 NCBI36
  
ATAAATGAAAAAAGAAAGACCTCAT G → A AGGTAATTATTGTGTAGGCTCATTG
+ 
 
n=
G/G=
G/A=
A/A=
A=
160
80
0
0
0.000
160
80
0
0
0.000
118
59
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
 PDE
100784708 GRCh37
99308839 NCBI36
  
GACCTCATGAGGTAATTATTGTGTA G → A GCTCATTGGTAAAAAATGGTTGTCA
+ 
 
n=
G/G=
G/A=
A/A=
A=
160
80
0
0
0.000
160
78
2
0
0.013
118
59
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
100784775 GRCh37
99308906 NCBI36
  
CACAACTATATCTGATTTCTCATTT C → A CAGACAGCACAGTTTAACTGGGATC
+ 
 
n=
C/C=
C/A=
A/A=
A=
160
77
3
0
0.019
160
79
1
0
0.006
118
59
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
100787376 GRCh37
99311507 NCBI36
  
TCAGTTTTTTTCTATATTTTCTTCC T → G TTTCCTGCTGTTTCCATTCTCTGGT
+ 
 
n=
T/T=
T/G=
G/G=
G=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
100790024 GRCh37
99314155 NCBI36
  
TAAATTGGGCTTTTATATTGTAGCC T → C GTGTGAAGAAGCAGCATCCATATTT
+ 
 
n=
T/T=
T/C=
C/C=
C=
160
76
4
0
0.025
158
77
2
0
0.013
120
60
0
0
0.000
100
48
2
0
0.020
12
6
0
0
0.000
Set-II
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 5: CodingPDE
100790177 GRCh37
99314308 NCBI36
971658
ACCACCTTTGGAGAGAAGCCGACTG G → A CCACAACCTCTTTTTGTGGTGGGTA
+220
Ala → Thr
(D=58)
n=
G/G=
G/A=
A/A=
A=
160
80
0
0
0.000
158
79
0
0
0.000
120
60
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
 PDE
100795499 GRCh37
99319630 NCBI36
  
ACTTTACCATATGAATTCTAAATGA G → A CTGAAAAGGCTTGCATGATGATTGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
158
79
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 6: CodingPDEI
100795589 GRCh37
99319720 NCBI36
1024711
CAGGGGCAGTGGTTGCCATGCCCCT G → A GCTGGGGTGTTGGTGCAGTACATTG
+237
Leu = Leu
n=
G/G=
G/A=
A/A=
A=
158
67
11
1
0.082
160
80
0
0
0.000
120
60
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
Exon 6: CodingPDE
100795601 GRCh37
99319732 NCBI36
1036723
TTGCCATGCCCCTGGCTGGGGTGTT G → A GTGCAGTACATTGGATGGTCCTCTG
+241
Leu = Leu
n=
G/G=
G/A=
A/A=
A=
158
79
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 6: CodingPDEI
100795615 GRCh37
99319746 NCBI36
1050737
GCTGGGGTGTTGGTGCAGTACATTG G → A ATGGTCCTCTGTCTTTTATATTTAT
+246
Gly → Glu
(D=98)
n=
G/G=
G/A=
A/A=
A=
158
79
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDEIA
100795699 GRCh37
99319830 NCBI36
  
ACTCATAGAGATGGTATTTTACTGC A → G TATGGGTTTGGCTCAGAGTTCATTA
+ 
 
n=
A/A=
A/G=
G/G=
G=
158
52
22
5
0.203
160
32
36
12
0.375
120
52
8
0
0.067
100
36
11
3
0.170
12
2
4
0
0.333
Set-II
 PDE
100796069 GRCh37
99320200 NCBI36
  
TGGTAAAAATTGAAAAATTTAGAAA C → T GGAAGAAAATGAGACCATATAACCC
+ 
 
n=
C/C=
C/T=
T/T=
T=
160
68
11
1
0.081
160
80
0
0
0.000
120
60
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
 PDE
100797770 GRCh37
99321901 NCBI36
  
GGGCAAGGGAATTAGGGAGGCCCCT C → G TCTCAGAAATAATGACAAACTGCTT
+ 
 
n=
C/C=
C/G=
G/G=
G=
160
68
11
1
0.081
160
80
0
0
0.000
120
60
0
0
0.000
100
48
2
0
0.020
12
6
0
0
0.000
Set-II
 PDEI
100806503 GRCh37
99330634 NCBI36
  
GATAAATAAATGAACTTGGGTTGAC C → T GATATGAAAATGACATTTTTTTCCC
+ 
 
n=
C/C=
C/T=
T/T=
T=
160
35
35
10
0.344
160
25
38
17
0.450
118
45
13
1
0.127
100
22
20
8
0.360
12
2
4
0
0.333
Set-II
 PDEI
100806715 GRCh37
99330846 NCBI36
  
CTATAGATTCAACAAGTCCCAGGAA G → T AAGGAAGGACAAGGATATTGTAGCA
+ 
 
n=
G/G=
G/T=
T/T=
T=
160
77
3
0
0.019
160
71
9
0
0.056
118
31
25
3
0.263
100
42
8
0
0.080
12
5
1
0
0.083
Set-II
 PDE
100811784 GRCh37
99335915 NCBI36
  
TGAAATTCTGTTCTTGACTCTGATT T → C TGAGGTTTTGGCTTCACTGTAGGTT
+ 
 
n=
T/T=
T/C=
C/C=
C=
160
78
2
0
0.013
160
80
0
0
0.000
118
59
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
 PDE
100811790 GRCh37
99335921 NCBI36
  
TCTGTTCTTGACTCTGATTTTGAGG T → A TTTGGCTTCACTGTAGGTTTTAATG
+ 
 
n=
T/T=
T/A=
A/A=
A=
160
80
0
0
0.000
160
80
0
0
0.000
118
58
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
100811969 GRCh37
99336100 NCBI36
  
TCCTTTGTGGCTATGGGTTACAATA T → C CAGAGGACTGGAGCTCTACACAAAC
+ 
 
n=
T/T=
T/C=
C/C=
C=
160
80
0
0
0.000
160
80
0
0
0.000
118
58
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 12: 3UTRPDE
100813976 GRCh37
99338107 NCBI36
2122 
CTTCTGTCTTCTCCTTACTTTAGAA A → C CAGAAAGTATCCATACCTATTGCCT
+ 
 
n=
A/A=
A/C=
C/C=
C=
160
26
38
16
0.438
150
20
39
16
0.473
112
44
11
1
0.116
94
21
18
8
0.362
12
2
4
0
0.333
Set-II

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.