UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:VMAT1
HGNC Symbol:SLC18A1
HGNC Description:solute carrier family 18 (vesicular monoamine transporter), member 1
HGNC ID:10934
Superfamily:SLC
Chromosome:Chr.8(-): 20002366-20040717 GRCh37
Location:8p21.3
OMIM:193002
OMIM Phenotype:None
Accessions:U39905
Nucleotide RefSeq:NM_003053
Protein RefSeq:NP_003044
Entrez:6570
Ensembl:ENSG00000036565
Isoforms:4
Evidence:Substrate In Vitro Evidence: 1. Expressed in digitonin-permeabilized fibroblastic (CV-1) cells. Transports serotonin utilizing an electrochemical gradient. Inhibited by fenfluramine. Erickson, JD et al. PNAS 1996 May 14, 93(10):5166-71 PMID 8643547. 2. In transfected CV-1 cells, the rank order for substrate inhibition of tritiated serotonin is : dopamine>epinephrine>norepinephrine>1-methyl-4-phenylpyridinium>2-phenylethylamine>histamine. Erickson, JD; Eiden, LE. J Nerochem 1993 Dec, 61(6):2314-7 PMID 8245983. 3. A mutation in a conserved proline residue affects activity, glycosylation, and localiation of rat VMAT1. Yelin, R et al. J Neurochem 1998 Dec, 71(6):2518-27 PMID 9832151. Tissue Distribution Evidence: 1. Expressed exclusively in neuroendocrine cells. Erickson, JD et al. PNAS 1996 May 14, 93(10):5166-71 PMID 8643547. 2. IHC demonstrated expression in serotonin-containing pancreatic endocrine tumors. Anlauf, M et al. J Histochem Cytochem 2003 Aug, 51(8):1027-40 PMID 12871984.
Tissues:neuroendocrine cells, serotonin-containing pancreatic endocrine tumors
Type:protein-coding
Sets:I,IV
PharmGKB ID:PA324
HPRD ID:01897
Substrates:serotonin
Trivial Names:CGAT, VAT1, VMAT1
Transcripts:NM_003053.3 [Chr.8(-): 20002366-20040717 GRCh37]
NM_001135691.2 [Chr.8(-): 20002366-20040717 GRCh37]
NM_001142324.1 [Chr.8(-): 20002366-20040717 GRCh37]
NM_001142325.1 [Chr.8(-): 20002366-20040717 GRCh37]
ENST00000265808 [Chr.8(-): 20002366-20040626 GRCh37]
ENST00000276373 [Chr.8(-): 20002366-20040717 GRCh37]
ENST00000381608 [Chr.8(-): 20003299-20038475 GRCh37]
ENST00000437980 [Chr.8(-): 20002367-20040717 GRCh37]
ENST00000440926 [Chr.8(-): 20002367-20040717 GRCh37]
ENST00000517776 [Chr.8(-): 20002370-20040636 GRCh37]
ENST00000519026 [Chr.8(-): 20003009-20040683 GRCh37]
ENST00000519171 [Chr.8(-): 20005114-20008507 GRCh37]
ENST00000522513 [Chr.8(-): 20028614-20040628 GRCh37]
ENST00000524272 [Chr.8(-): 20028616-20033433 GRCh37]
Annotation History:View Events (5)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC18A1.

Variant Data

View all PMT variants for SLC18A1 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC18A1 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC18A1 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
PromoterPDE
20040892 GRCh37
20085172 NCBI36
-175-2417
GACCCAGGCAAGAGTTAAAGAGTTC G → T ATGATAGATAAGCACAGATGCAAAA
- 
 
n=
G/G=
G/T=
T/T=
T=
134
65
2
0
0.015
134
67
0
0
0.000
132
66
0
0
0.000
128
64
0
0
0.000
n/a
0.000
PMT-272
Exon 1: 5UTR
Promoter
PDEI
20040712 GRCh37
20084992 NCBI36
6-2237
TCTTTGTGGACAAAGGCACACACAC A → G CACACATACACAGAATCCTCAGATA
- 
 
n=
A/A=
A/G=
G/G=
G=
134
43
22
2
0.194
134
17
30
20
0.522
132
50
13
3
0.144
128
28
28
8
0.344
n/a
0.000
PMT-272
Exon 2: 5UTRPDE
20038508 GRCh37
20082788 NCBI36
235-33
GTCACAGGACCTTCCCTAAGAGCCC G → T CAGGGGAAGACTGCCCCAGTCCGGC
- 
 
n=
G/G=
G/T=
T/T=
T=
200
100
0
0
0.000
200
100
0
0
0.000
60
29
1
0
0.017
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 2: CodingPDE6 pubsA
20038466 GRCh37
20082746 NCBI36
27710
CAGTCCGGCCATCACCATGCTCCGG A → C CCATTCTGGATGCTCCCCAGCGGTT
-4
Thr → Pro
(D=38)
n=
A/A=
A/C=
C/C=
C=
200
100
0
0
0.000
200
100
0
0
0.000
60
29
1
0
0.017
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDEI
20037017 GRCh37
20081297 NCBI36
  
ATGACATCGGTCCTTAGCCCCCATC A → G CCTGTCCTCTTTGACTTTCAGTGCC
- 
 
n=
A/A=
A/G=
G/G=
G=
184
68
20
4
0.152
190
36
50
9
0.358
60
25
3
2
0.117
20
5
5
0
0.250
14
3
3
1
0.357
Set-I
Exon 3: CodingPDE
20036899 GRCh37
20081179 NCBI36
488221
GCCGGAAGTTCCCCACATGCCCTCG C → T CTCTCCTGCCTTTTCCACCATCTTC
-74
Ala → Val
(D=64)
n=
C/C=
C/T=
T/T=
T=
196
97
1
0
0.005
196
98
0
0
0.000
60
30
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
Exon 3: CodingPDEI
20036875 GRCh37
20081155 NCBI36
512245
GCCTCTCCTGCCTTTTCCACCATCT T → G CTCCTTCTTCAACAACAACACCGTG
-82
Phe → Cys
(D=205)
n=
T/T=
T/G=
G/G=
G=
196
98
0
0
0.000
196
97
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 3: CodingPDE1 pub
20036869 GRCh37
20081149 NCBI36
518251
CCTGCCTTTTCCACCATCTTCTCCT T → C CTTCAACAACAACACCGTGGCTGTT
-84
Phe → Ser
(D=155)
n=
T/T=
T/C=
C/C=
C=
196
87
10
1
0.061
196
98
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 3: CodingPDE4 pubsIA
20036827 GRCh37
20081107 NCBI36
560293
GTGGCTGTTGAAGAAAGCGTACCTA G → C TGGAATAGCATGGATGAATGACACT
-98
Ser → Thr
(D=58)
n=
G/G=
G/C=
C/C=
C=
196
62
31
5
0.209
196
63
32
3
0.194
60
19
7
4
0.250
20
8
2
0
0.100
14
5
2
0
0.143
Set-I
Exon 3: CodingPDE
20036819 GRCh37
20081099 NCBI36
568301
TGAAGAAAGCGTACCTAGTGGAATA G → C CATGGATGAATGACACTGCCAGCAC
-101
Ala → Pro
(D=27)
n=
G/G=
G/C=
C/C=
C=
196
91
7
0
0.036
196
98
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 3: CodingPDE
20036817 GRCh37
20081097 NCBI36
570303
AAGAAAGCGTACCTAGTGGAATAGC A → T TGGATGAATGACACTGCCAGCACCA
-101
Ala = Ala
n=
A/A=
A/T=
T/T=
T=
196
98
0
0
0.000
196
98
0
0
0.000
60
29
1
0
0.017
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 3: CodingPDE4 pubsIA
20036713 GRCh37
20080993 NCBI36
674407
GGCACAGGTTTCTTGGAGGAAGAGA T → C TACCCGGGTCGGGGTTCTGTTTGCT
-136
Ile → Thr
(D=89)
n=
T/T=
T/C=
C/C=
C=
196
2
20
76
0.878
196
9
33
56
0.740
60
3
8
19
0.767
20
1
7
2
0.550
14
0
3
4
0.786
Set-I
Exon 3: CodingPDEI
20036702 GRCh37
20080982 NCBI36
685418
CTTGGAGGAAGAGATTACCCGGGTC G → A GGGTTCTGTTTGCTTCAAAGGCTGT
-140
Gly → Arg
(D=125)
n=
G/G=
G/A=
A/A=
A=
196
98
0
0
0.000
196
97
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 
20036016 GRCh37
20080296 NCBI36
  
TGGAATTGTATCTTTTTTTTTTTCA A → AA TTCCCTTTTAGGATTGGATATCATA
- 
 
n=
A/A=
A/AA=
AA/AA=
AA=
196
74
24
0
0.122
190
64
26
5
0.189
42
16
4
1
0.143
10
2
3
0
0.300
6
1
2
0
0.333
Set-I
Exon 4: CodingPDE
20036001 GRCh37
20080281 NCBI36
759492
TTTTTTTTCAATTCCCTTTTAGGAT T → G GGATATCATATCCCCATGTTTGCTG
-164
Ile → Met
(D=10)
n=
T/T=
T/G=
G/G=
G=
196
96
2
0
0.010
190
95
0
0
0.000
42
21
0
0
0.000
10
5
0
0
0.000
6
3
0
0
0.000
Set-I
 PDE
20031998 GRCh37
20076278 NCBI36
  
TTCTCTGGCGGCTGGGGAAGCAAAG G → C CAATTTGCTAACTGCAGTTATCTTG
- 
 
n=
G/G=
G/C=
C/C=
C=
200
100
0
0
0.000
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 5: CodingPDE
20031898 GRCh37
20076178 NCBI36
872605
TTTGTGGCCCGAACCCTTCAAGGCA T → C TGGATCTTCATTTTCATCTGTTGCA
-202
Ile → Thr
(D=89)
n=
T/T=
T/C=
C/C=
C=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
20030502 GRCh37
20074782 NCBI36
  
GCTCTGGGTTCGGGAGGGTGGGACT C → T TAGGAAGCAGGTGTTCCCGAGGTGT
- 
 
n=
C/C=
C/T=
T/T=
T=
200
98
2
0
0.010
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 7: CodingPDEI
20028985 GRCh37
20073265 NCBI36
1012745
TCCAGTGGGAGCTCCCTTTGGAAGT G → A TAATGTACGAGTTTGTTGGGAAGTC
-249
Val → Ile
(D=29)
n=
G/G=
G/A=
A/A=
A=
178
87
2
0
0.011
192
96
0
0
0.000
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 7: CodingPDE
20028977 GRCh37
20073257 NCBI36
1020753
GAGCTCCCTTTGGAAGTGTAATGTA C → T GAGTTTGTTGGGAAGTCTGCACCCT
-251
Tyr = Tyr
n=
C/C=
C/T=
T/T=
T=
178
81
8
0
0.045
192
94
2
0
0.010
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 PDE
20028898 GRCh37
20073178 NCBI36
  
GGATGGAGGTAAGTCACCATCAGAG C → A CTCCAGCAGGTGACAGCCCAGGTCA
- 
 
n=
C/C=
C/A=
A/A=
A=
178
89
0
0
0.000
194
96
1
0
0.005
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
20028895 GRCh37
20073175 NCBI36
  
TGGAGGTAAGTCACCATCAGAGCCT C → A CAGCAGGTGACAGCCCAGGTCAGGT
- 
 
n=
C/C=
C/A=
A/A=
A=
178
85
4
0
0.022
194
83
13
1
0.077
58
27
2
0
0.034
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
20028878 GRCh37
20073158 NCBI36
  
CAGAGCCTCCAGCAGGTGACAGCCC A → C GGTCAGGTTGGGAATGCATTATGTT
- 
 
n=
A/A=
A/C=
C/C=
C=
178
87
2
0
0.011
194
97
0
0
0.000
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
20028877 GRCh37
20073157 NCBI36
  
AGAGCCTCCAGCAGGTGACAGCCCA G → C GTCAGGTTGGGAATGCATTATGTTG
- 
 
n=
G/G=
G/C=
C/C=
C=
178
89
0
0
0.000
194
96
1
0
0.005
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
20028870 GRCh37
20073150 NCBI36
  
CCAGCAGGTGACAGCCCAGGTCAGG T → C TGGGAATGCATTATGTTGTAGTGTC
- 
 
n=
T/T=
T/C=
C/C=
C=
178
89
0
0
0.000
194
97
0
0
0.000
58
28
1
0
0.017
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDEA
20028830 GRCh37
20073110 NCBI36
  
GTTGTAGTGTCAGTCTTCACTAAGA A → G TGGGCGGTTTGGACATGTTTTGATG
- 
 
n=
A/A=
A/G=
G/G=
G=
178
70
17
2
0.118
194
37
51
9
0.356
58
23
5
1
0.121
20
5
5
0
0.250
14
3
3
1
0.357
Set-I
 PDE
20028750 GRCh37
20073030 NCBI36
  
AAGAAGAAACTCAGGGAGTTAAATT T → G ATGCATAATAGGGTGGTAGCACTAC
- 
 
n=
T/T=
T/G=
G/G=
G=
178
88
1
0
0.006
194
83
13
1
0.077
58
27
2
0
0.034
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
20028727 GRCh37
20073007 NCBI36
  
TTTATGCATAATAGGGTGGTAGCAC T → C ACAGCTGTTATTGGAGCCCCCAGCT
- 
 
n=
T/T=
T/C=
C/C=
C=
178
82
7
0
0.039
194
97
0
0
0.000
58
29
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
 PDE
20028715 GRCh37
20072995 NCBI36
  
AGGGTGGTAGCACTACAGCTGTTAT T → G GGAGCCCCCAGCTAATCAGTAGACA
- 
 
n=
T/T=
T/G=
G/G=
G=
178
89
0
0
0.000
194
97
0
0
0.000
58
29
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
 PDE
20028695 GRCh37
20072975 NCBI36
  
GTTATTGGAGCCCCCAGCTAATCAG T → C AGACACGCTGAACTGTCTCACCTTC
- 
 
n=
T/T=
T/C=
C/C=
C=
178
89
0
0
0.000
194
96
1
0
0.005
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
20022541 GRCh37
20066821 NCBI36
  
TGGCTGCAGGTAAGCTGGCGATGAC C → G TCCCATTGGGCGGGGAGTGTCTGGG
- 
 
n=
C/C=
C/G=
G/G=
G=
200
98
2
0
0.010
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
20022501 GRCh37
20066781 NCBI36
  
GAGTGTCTGGGCTTCAAGCAGCCAC G → A GCTGCTCACAGAACAGTCTCCCCAG
- 
 
n=
G/G=
G/A=
A/A=
A=
200
98
2
0
0.010
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
20008267 GRCh37
20052547 NCBI36
  
GACATGTCCTAAGGTAAGGATCTGT G → A TCCTTCCACAGGTCTAGCTTTCTTG
- 
 
n=
G/G=
G/A=
A/A=
A=
198
98
1
0
0.005
198
99
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 11: CodingPDEI
20008206 GRCh37
20052486 NCBI36
13321065
TGTCCTACCTCATTGGCACCAACCT C → T TTTGGTGTGTTGGCCAACAAGATGG
-355
Leu = Leu
n=
C/C=
C/T=
T/T=
T=
200
99
1
0
0.005
200
99
1
0
0.005
60
21
7
2
0.183
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDEI
20008164 GRCh37
20052444 NCBI36
  
ACAAGATGGGTCGGTATGTAGCCTC G → A GGATCTGGGACGAACAGTAGAAATG
- 
 
n=
G/G=
G/A=
A/A=
A=
200
99
1
0
0.005
200
99
1
0
0.005
60
22
6
2
0.167
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
20008155 GRCh37
20052435 NCBI36
  
GTCGGTATGTAGCCTCGGGATCTGG G → A ACGAACAGTAGAAATGTAAGATGGA
- 
 
n=
G/G=
G/A=
A/A=
A=
200
99
1
0
0.005
200
80
17
3
0.115
60
29
1
0
0.017
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 13: CodingPDE
20005564 GRCh37
20049844 NCBI36
14311164
CCATGCAGGTTCCTCTGGCTCACAA T → C ATTTTTGGTCTCATTGGCCCCAATG
-388
Asn = Asn
n=
T/T=
T/C=
C/C=
C=
200
97
3
0
0.015
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 13: CodingPDE3 pubsIA
20005554 GRCh37
20049834 NCBI36
14411174
TCCTCTGGCTCACAATATTTTTGGT C → G TCATTGGCCCCAATGCAGGGCTTGG
-392
Leu → Val
(D=32)
n=
C/C=
C/G=
G/G=
G=
200
99
1
0
0.005
200
80
17
3
0.115
60
29
1
0
0.017
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 13: CodingPDE
20005534 GRCh37
20049814 NCBI36
14611194
TTGGTCTCATTGGCCCCAATGCAGG G → T CTTGGCCTTGCCATAGGTAAGAAGT
-398
Gly = Gly
n=
G/G=
G/T=
T/T=
T=
200
94
6
0
0.030
200
100
0
0
0.000
60
30
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
Exon 14: CodingPDEI
20005154 GRCh37
20049434 NCBI36
15571290
ACACCTCGGTGTATGGGAGTGTCTA C → T GCCATCGCTGATGTGGCTTTTTGCA
-430
Tyr = Tyr
n=
C/C=
C/T=
T/T=
T=
200
93
7
0
0.035
200
98
2
0
0.010
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 PDE
20005083 GRCh37
20049363 NCBI36
  
TTGGCAGGACCTGGTGCCCCACTTT C → T CCCTGTCTACTCTTTACCAGCTGGA
- 
 
n=
C/C=
C/T=
T/T=
T=
200
91
9
0
0.045
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
20005075 GRCh37
20049355 NCBI36
  
ACCTGGTGCCCCACTTTCCCCTGTC T → C ACTCTTTACCAGCTGGAAGTGCAGC
- 
 
n=
T/T=
T/C=
C/C=
C=
200
69
28
3
0.170
200
97
3
0
0.015
60
22
6
2
0.167
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 15: CodingPDE
20004868 GRCh37
20049148 NCBI36
16321365
CCGGTGGTGCCATTGTAAAGGCCAT C → A GGTTTTCCCTGGCTCATGGTCATCA
-455
Ile = Ile
n=
C/C=
C/A=
A/A=
A=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 15: CodingPDE
20004826 GRCh37
20049106 NCBI36
16741407
TGGTCATCACTGGGGTCATCAACAT C → T GTCTATGCTCCACTCTGCTACTACC
-469
Ile = Ile
n=
C/C=
C/T=
T/T=
T=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 15: CodingPDE
20004784 GRCh37
20049064 NCBI36
17161449
GCTACTACCTGCGGAGCCCCCCGGC A → G AAGGAAGAGAAGCTTGTAAGGAGCA
-483
Ala = Ala
n=
A/A=
A/G=
G/G=
G=
198
93
6
0
0.030
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 16: 3UTRPDE
20003250 GRCh37
20047530 NCBI36
1869 
AGCAGCAGAAGGTGCTCCTTGAATT C → A ATGATGCCTCAGTGACCACCTCTTT
- 
 
n=
C/C=
C/A=
A/A=
A=
194
90
7
0
0.036
190
95
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
12
6
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.