UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:VMAT2
HGNC Symbol:SLC18A2
HGNC Description:solute carrier family 18 (vesicular monoamine transporter), member 2
HGNC ID:10935
Superfamily:SLC
Chromosome:Chr.10(+): 119000584-119038941 GRCh37
Location:10q25
OMIM:193001
OMIM Phenotype:None
Accessions:X71354
Nucleotide RefSeq:NM_003054
Protein RefSeq:NP_003045
Entrez:6571
Ensembl:ENSG00000165646
Isoforms:1
Evidence:Substrate In Vitro Evidence: Serotonin in digitonin-permeabilized fibroblastic (CV-1) cells Catecholamines in digitonin-permeabilized fibroblastic (CV-1) cells Histamine in digitonin-permeabilized fibroblastic (CV-1) cells Erickson et al 1996, PNAS, Vol 93 (10), p.5166-71 Dopamine, adrenaline, and noradrenaline Eiden et al 2003, Pflugers Arch Substrate In Vivo Evidence: Homozygous K.O. mouse is lethal. Mice heterozygous for VMAT2 show a gene-dosage effect: the levels of dopamine, serotonin, and norepinephrine in the brain of heterozygotes are half of what is observed in mice homozygous for VMAT2 Eiden et al 2003, Pflugers Arch Fon et al 1997, Neuron, Vol 19, p.1271-1283 Takahashi et al 1997, PNAS, Vol 94, p.9938-9943 Wang et al 1997, Neuron, Vol 19, p.1285-96 Chemicaly inhibited by several molecules including: reserpine, ketanserin, N-methyl-4-phenylpyridinium, phenylethylamine, amphetamine, methylenedioxymethamphetamine, and tetrabenzaine Erickson et al 1996, PNAS, Vol 93 (10), p.5166-71 Tissue Distribution Evidence: Central, peripheral, and enteric neurons. Also expressed in chromaffin cells of the adrenal medulla and in histamine-storing enterochromaffin-like cells of the oxyntic mucosa of the stomach by isoform-specific ployclonal antibodies Erickson et al 1996, PNAS, Vol 93 (10), p.5166-71
Tissues:brain (neurons), adrenal gland, sympathetic ganglia, carotid body, small and large intestine, stomach, endocrine
Type:protein-coding
Sets:IV
PharmGKB ID:PA325
HPRD ID:01896
Substrates:5HT, dopamine, adrenaline, noradrenaline, histamine
Trivial Names:SVAT, SVMT, VAT2, VMAT2
Transcripts:NM_003054.4 [Chr.10(+): 119000584-119038941 GRCh37]
ENST00000298472 [Chr.10(+): 119000604-119038941 GRCh37]
ENST00000497497 [Chr.10(+): 119000604-119038941 GRCh37]
Annotation History:View Events (2)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC18A2.

Variant Data

View all PMT variants for SLC18A2 on UCSC Genome Browser
Showing SNP features for transcript: NM_003054  
SLC18A2 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC18A2 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqUnknown FreqSample Set
PromoterPDE
119000531 GRCh37
118990521 NCBI36
-53-674
CCTGCGCAGCGACGGCGCGGGCGGG C → A GGAGGCCGGGGCGCCCCAGCCCCCC
+ 
 
n=
C/C=
C/A=
A/A=
A=
130
38
16
11
0.292
136
6
30
32
0.691
134
48
17
2
0.157
132
12
26
28
0.621
n/a
0.000
PMT-272
PromoterPDE
119000560 GRCh37
118990550 NCBI36
-24-645
GGCCGGGGCGCCCCAGCCCCCCGCC C → T CCGCTCCCTCCGGCCGTGACGTCAG
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
55
10
0
0.077
136
61
6
1
0.059
134
47
20
0
0.149
132
48
13
5
0.174
n/a
0.000
PMT-272
PromoterPDE
119000572 GRCh37
118990562 NCBI36
-12-633
CCAGCCCCCCGCCCCCGCTCCCTCC G → A GCCGTGACGTCAGAGCCGGACGGGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
61
4
0
0.031
136
35
32
1
0.250
134
12
29
26
0.604
132
51
14
1
0.121
n/a
0.000
PMT-272
Exon 1: 5UTRPDE
119000684 GRCh37
118990674 NCBI36
101-521
GACGGAGCCCACTGCGGTGCGGGCG T → C TGGCGCGGGCACGGAGGACCCGGGC
+ 
 
n=
T/T=
T/C=
C/C=
C=
130
58
7
0
0.054
136
68
0
0
0.000
134
67
0
0
0.000
132
66
0
0
0.000
n/a
0.000
PMT-272
Exon 1: 5UTRPDE
119000691 GRCh37
118990681 NCBI36
108-514
CCCACTGCGGTGCGGGCGTTGGCGC G → A GGCACGGAGGACCCGGGCAGGCATC
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
64
1
0
0.008
136
68
0
0
0.000
134
67
0
0
0.000
132
66
0
0
0.000
n/a
0.000
PMT-272
Exon 3: CodingPDE
119003546 GRCh37
118993536 NCBI36
349186
AGAAGAATGCTACAGAAATCCAGAC G → A GCCAGGCCAGTGCACACTGCCTCCA
+62
Thr = Thr
n=
G/G=
G/A=
A/A=
A=
n/a
0.000
n/a
0.000
n/a
0.000
n/a
0.000
898
448
1
0
0.001
PSG
Exon 3: CodingPDE4 pubsI
119003564 GRCh37
118993554 NCBI36
367204
TCCAGACGGCCAGGCCAGTGCACAC T → G GCCTCCATCTCAGACAGCTTCCAGA
+68
Thr = Thr
n=
T/T=
T/G=
G/G=
G=
n/a
0.000
n/a
0.000
n/a
0.000
n/a
0.000
898
414
35
0
0.039
PSG
 PDE
119003847 GRCh37
118993837 NCBI36
  
CAGGTAGGGCAGACTACTTTAGTCA A → - AGAGTTTGATATTTGTATCAGTCCT
+ 
 
n=
A/A=
A/-=
-/-=
-=
n/a
0.000
n/a
0.000
n/a
0.000
n/a
0.000
898
414
35
0
0.039
PSG
 
119003848 GRCh37
118993838 NCBI36
  
AGGTAGGGCAGACTACTTTAGTCAA A → - GAGTTTGATATTTGTATCAGTCCTA
+ 
 
n=
A/A=
A/-=
-/-=
-=
n/a
0.000
n/a
0.000
n/a
0.000
n/a
0.000
898
414
35
0
0.039
PSG
 PDE
119013530 GRCh37
119003520 NCBI36
  
ACGGTTGTGTCCCAGCAGCACTGAT G → A TGCGGTCTTGGACCCCCTCTCTCGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
n/a
0.000
n/a
0.000
n/a
0.000
n/a
0.000
898
448
1
0
0.001
PSG
Exon 5: CodingPDE1 pubI
119013583 GRCh37
119003573 NCBI36
711548
GTGTTTGCCTTCTCCAGCAGCTATG C → G CTTCCTGCTGATTGCCAGGTCGCTG
+183
Ala → Gly
(D=60)
n=
C/C=
C/G=
G/G=
G=
n/a
0.000
n/a
0.000
n/a
0.000
n/a
0.000
898
448
1
0
0.001
PSG
Exon 5: CodingPDE
119013596 GRCh37
119003586 NCBI36
724561
CCAGCAGCTATGCCTTCCTGCTGAT T → C GCCAGGTCGCTGCAGGGCATCGGCT
+187
Ile = Ile
n=
T/T=
T/C=
C/C=
C=
n/a
0.000
n/a
0.000
n/a
0.000
n/a
0.000
898
448
1
0
0.001
PSG
Exon 5: CodingPDEA
119013632 GRCh37
119003622 NCBI36
760597
TGCAGGGCATCGGCTCGTCCTGCTC C → T TCTGTGGCTGGTAGGTGTGGAATGC
+199
Ser = Ser
n=
C/C=
C/T=
T/T=
T=
n/a
0.000
n/a
0.000
n/a
0.000
n/a
0.000
898
438
11
0
0.012
PSG
 PDE
119014023 GRCh37
119004013 NCBI36
  
GGGGGTCTTAGGTGGGTAAGGCCCC T → C GTGTAGGCAAACTGGCAAGAGGGGC
+ 
 
n=
T/T=
T/C=
C/C=
C=
n/a
0.000
n/a
0.000
n/a
0.000
n/a
0.000
898
443
6
0
0.007
PSG
 PDE
119017229 GRCh37
119007219 NCBI36
  
AGTAGAAGTTGCGGTTATCTGAGCT G → - TAGGCGCATGGAGTCTAACTGTGCC
+ 
 
n=
G/G=
G/-=
-/-=
-=
n/a
0.000
n/a
0.000
n/a
0.000
n/a
0.000
898
448
1
0
0.001
PSG
 PDE
119017230 GRCh37
119007220 NCBI36
  
GTAGAAGTTGCGGTTATCTGAGCTG T → - AGGCGCATGGAGTCTAACTGTGCCT
+ 
 
n=
T/T=
T/-=
-/-=
-=
n/a
0.000
n/a
0.000
n/a
0.000
n/a
0.000
898
448
1
0
0.001
PSG
 PDE
119017231 GRCh37
119007221 NCBI36
  
TAGAAGTTGCGGTTATCTGAGCTGT A → - GGCGCATGGAGTCTAACTGTGCCTG
+ 
 
n=
A/A=
A/-=
-/-=
-=
n/a
0.000
n/a
0.000
n/a
0.000
n/a
0.000
898
448
1
0
0.001
PSG
 PDE
119017232 GRCh37
119007222 NCBI36
  
AGAAGTTGCGGTTATCTGAGCTGTA G → - GCGCATGGAGTCTAACTGTGCCTGG
+ 
 
n=
G/G=
G/-=
-/-=
-=
n/a
0.000
n/a
0.000
n/a
0.000
n/a
0.000
898
448
1
0
0.001
PSG
 PDE
119017233 GRCh37
119007223 NCBI36
  
GAAGTTGCGGTTATCTGAGCTGTAG G → - CGCATGGAGTCTAACTGTGCCTGGA
+ 
 
n=
G/G=
G/-=
-/-=
-=
n/a
0.000
n/a
0.000
n/a
0.000
n/a
0.000
898
448
1
0
0.001
PSG
 PDE
119017234 GRCh37
119007224 NCBI36
  
AAGTTGCGGTTATCTGAGCTGTAGG C → - GCATGGAGTCTAACTGTGCCTGGAA
+ 
 
n=
C/C=
C/-=
-/-=
-=
n/a
0.000
n/a
0.000
n/a
0.000
n/a
0.000
898
448
1
0
0.001
PSG
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqUnknown FreqSample Set
 PDE
119017243 GRCh37
119007233 NCBI36
  
TTATCTGAGCTGTAGGCGCATGGAG T → A CTAACTGTGCCTGGAAATGAGAGAG
+ 
 
n=
T/T=
T/A=
A/A=
A=
n/a
0.000
n/a
0.000
n/a
0.000
n/a
0.000
898
448
1
0
0.001
PSG
 PDE
119017254 GRCh37
119007244 NCBI36
  
GTAGGCGCATGGAGTCTAACTGTGC C → T TGGAAATGAGAGAGGAGGCAGAAGC
+ 
 
n=
C/C=
C/T=
T/T=
T=
n/a
0.000
n/a
0.000
n/a
0.000
n/a
0.000
898
448
1
0
0.001
PSG
 PDE
119017457 GRCh37
119007447 NCBI36
  
CAAGAGCATTTGTCCCCAGGGCAGC C → T TTTGTCCCCAGGGCATCCCTGCTGA
+ 
 
n=
C/C=
C/T=
T/T=
T=
n/a
0.000
n/a
0.000
n/a
0.000
n/a
0.000
898
442
7
0
0.008
PSG
 PDE
119026186 GRCh37
119016176 NCBI36
  
CATTGTGGTGTCTACAGTTATTACT T → G TTTCTAACATATGACTGATATCAGC
+ 
 
n=
T/T=
T/G=
G/G=
G=
n/a
0.000
n/a
0.000
n/a
0.000
n/a
0.000
898
437
11
1
0.014
PSG
 PDE
119026214 GRCh37
119016204 NCBI36
  
TCTAACATATGACTGATATCAGCAC T → C GATAAGGTCTCCTTTTCATAAATTT
+ 
 
n=
T/T=
T/C=
C/C=
C=
n/a
0.000
n/a
0.000
n/a
0.000
n/a
0.000
898
448
1
0
0.001
PSG
 PDE1 pubI
119026566 GRCh37
119016556 NCBI36
  
TTATGTGTGAGTAAAAGATGGCATT C → T GACAAGTGGGAACAATCTGTGAATA
+ 
 
n=
C/C=
C/T=
T/T=
T=
n/a
0.000
n/a
0.000
n/a
0.000
n/a
0.000
898
435
13
1
0.017
PSG

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.