UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:VACHT
HGNC Symbol:SLC18A3
HGNC Description:solute carrier family 18 (vesicular acetylcholine transporter), member 3
HGNC ID:10936
Superfamily:SLC
Chromosome:Chr.10(+): 50818347-50820766 GRCh37
Location:10q11.2
OMIM:600336
OMIM Phenotype:None
Accessions:U09210
Nucleotide RefSeq:NM_003055
Protein RefSeq:NP_003046
Entrez:6572
Ensembl:ENSG00000187714
Isoforms:1
Evidence:Substrate In Vitro Evidence: Acetylcholine in transfected fibroblast cells Erickson et al 1994, JBC, Vol 269 (35), p. 21929-32 Substrate In Vivo Evidence: Chemically inhibited by vesamicol Eiden et al 2003, Pflugers Arch Parsons et al 1993, Int Rev Neurobiol, Vol 35, p. 279-390 Homozygous knock-out of VAChT leads to failure of cholinergic neurotransmission in C. elegans Eiden et al 2003, Pflugers Arch Alfonso et al 1993, Science, Vol 261, p.617-19 Tissue Distribution Evidence: Neurons, peripheral nervous system, intestine, localized to synaptic vesicles. Co-expressed with the biosynthetic enzyme for generating acetylcholine (ChAT). Immunohistochemical methods Eiden 1998, J Neurochem, Vol 70 (6), p.2227-40 Eiden et al 2003, Pflugers Arch
Tissues:brain (neurons), peripheral nervous system (neurons), intestine (neurons), small synaptic vesicles
Type:protein-coding
Sets:I,IV
PharmGKB ID:PA326
HPRD ID:08979
Substrates:acetylcholine
Trivial Names:VACHT
Transcripts:NM_003055.2 [Chr.10(+): 50818347-50820766 GRCh37]
ENST00000374115 [Chr.10(+): 50818347-50820765 GRCh37]
Annotation History:View Events (2)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC18A3.

Variant Data

View all PMT variants for SLC18A3 on UCSC Genome Browser
Showing SNP features for transcript: NM_003055  
SLC18A3 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC18A3 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 1: 5UTRPDE
50818753 GRCh37
50488759 NCBI36
407-34
CGGGACGCCAGCGCTCGGCCCTGGC G → A GAGGCGTCCTCGGAAGAGCATCGGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 1: 5UTRPDE
50818762 GRCh37
50488768 NCBI36
416-25
AGCGCTCGGCCCTGGCGGAGGCGTC C → T TCGGAAGAGCATCGGGGTGGGGGCA
+ 
 
n=
C/C=
C/T=
T/T=
T=
200
1
21
78
0.885
200
0
0
100
1.000
60
2
10
18
0.767
20
1
2
7
0.800
14
0
2
5
0.857
Set-I
Exon 1: CodingPDE
50818818 GRCh37
50488824 NCBI36
47232
TCCGCGGAACCTGCGGGCCAGGCCC G → A GGCGGCGGCCACCAAGCTGTCGGAG
+11
Arg → Gln
(D=43)
n=
G/G=
G/A=
A/A=
A=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 1: CodingPDE
50818823 GRCh37
50488829 NCBI36
47737
GGAACCTGCGGGCCAGGCCCGGGCG G → C CGGCCACCAAGCTGTCGGAGGCTGT
+13
Ala → Pro
(D=27)
n=
G/G=
G/C=
C/C=
C=
200
92
8
0
0.040
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 1: CodingPDE
50818871 GRCh37
50488877 NCBI36
52585
TGTGGGCGCGGCGCTGCAGGAGCCC C → T GGCGGCAGAGGCGCCTGGTGCTTGT
+29
Arg → Trp
(D=101)
n=
C/C=
C/T=
T/T=
T=
200
97
3
0
0.015
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 1: CodingPDEI
50818874 GRCh37
50488880 NCBI36
52888
GGGCGCGGCGCTGCAGGAGCCCCGG C → A GGCAGAGGCGCCTGGTGCTTGTTAT
+30
Arg = Arg
n=
C/C=
C/A=
A/A=
A=
200
90
9
1
0.055
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 1: CodingPDE
50819182 GRCh37
50489188 NCBI36
836396
TCGGGGTGCTGTTTGCTTCCAAGGC T → C ATCCTGCAGCTGCTAGTGAACCCCT
+132
Ala = Ala
n=
T/T=
T/C=
C/C=
C=
200
91
9
0
0.045
200
99
1
0
0.005
60
18
10
2
0.233
20
8
1
1
0.150
14
5
2
0
0.143
Set-I
Exon 1: CodingPDE
50819401 GRCh37
50489407 NCBI36
1055615
TAGCCATGATCGCCGATAAGTACCC G → C GAGGAGCCGGAGCGCAGTCGTGCAC
+205
Pro = Pro
n=
G/G=
G/C=
C/C=
C=
196
90
8
0
0.041
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 1: CodingPDEI
50819422 GRCh37
50489428 NCBI36
1076636
ACCCGGAGGAGCCGGAGCGCAGTCG T → C GCACTGGGCGTGGCGCTGGCCTTCA
+212
Arg = Arg
n=
T/T=
T/C=
C/C=
C=
196
90
8
0
0.041
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 1: CodingPDE
50819701 GRCh37
50489707 NCBI36
1355915
CGCTCACCACCTGTAACATTCCCCT C → A GCCTTCCTCGAACCCACCATTGCCA
+305
Leu = Leu
n=
C/C=
C/A=
A/A=
A=
190
94
1
0
0.005
180
90
0
0
0.000
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 1: CodingPDEI
50819713 GRCh37
50489719 NCBI36
1367927
GTAACATTCCCCTCGCCTTCCTCGA A → G CCCACCATTGCCACGTGGATGAAGC
+309
Glu = Glu
n=
A/A=
A/G=
G/G=
G=
190
87
8
0
0.042
180
89
1
0
0.006
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 1: CodingPDE
50820345 GRCh37
50490351 NCBI36
19991559
CGCAGCCCGCCTGGCCCTTTTGATG C → A GTGCGAGGACGACTACAACTACTAC
+520
Ala → Glu
(D=107)
n=
C/C=
C/A=
A/A=
A=
200
86
1
13
0.135
200
88
0
12
0.120
60
28
0
2
0.067
20
8
0
2
0.200
14
7
0
0
0.000
Set-I
Exon 1: 3UTRPDE
50820424 GRCh37
50490430 NCBI36
2078 
CCTCCAGCCCACCCAACCGCCTTGG G → T TCAAGGGGGCTGCTCTGCAAGCCCA
+ 
 
n=
G/G=
G/T=
T/T=
T=
200
93
7
0
0.035
200
98
2
0
0.010
60
28
1
1
0.050
20
8
1
1
0.150
14
7
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.