UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:RFC1
HGNC Symbol:SLC19A1
HGNC Description:solute carrier family 19 (folate transporter), member 1
HGNC ID:10937
Superfamily:SLC
Chromosome:Chr.21(-): 46934629-46983045 GRCh37
Location:21q22.3
OMIM:600424
OMIM Phenotype:None
Accessions:NM_003056
Nucleotide RefSeq:NM_194255
Protein RefSeq:NP_919231
Entrez:6573
Ensembl:ENSG00000173638
Isoforms:5
Evidence:Substrate In Vitro Evidence: folate Gastroenterology. 1997 Mar;112(3):783-91. X oocytes methotrexate Gastroenterology. 1997 Mar;112(3):783-91. X oocytes folinic acid Gastroenterology. 1997 Mar;112(3):783-91. X oocytes folic acid Gastroenterology. 1997 Mar;112(3):783-91. X oocytes 4,4'-diisothiocyanostilbene-2,2'-disulfonic acid Gastroenterology. 1997 Mar;112(3):783-91. X oocytes methotrexate 5 ZR-75-1 cells (methotrexate-resistant) Substrate In Vivo Evidence: mRFC gene knock-out results in embryonic death if folic acid supplements are not provided 45 knock-out mouse Tissue Distribution Evidence: ubiquitously expressed (highest levels in placenta) 36 Northern tissue-specific levels of expression due to alternate splicing of 5'UTR 36 5'RACE
Tissues:ubiquitously expressed (highest levels in placenta)
Type:protein-coding
Sets:III,IV
PharmGKB ID:PA327
HPRD ID:02691
Substrates:folate, methotrexate, folinic acid, folic acid, 4,4'-diisothiocyanostilbene-2,2'-disulfonic acid, methotrexate
Trivial Names:CHMD, FOLT, IFC1, REFC, RFC1
Transcripts:NM_194255.2 [Chr.21(-): 46934629-46962385 GRCh37]
NM_001205206.1 [Chr.21(-): 46934629-46962385 GRCh37]
NM_001205207.1 [Chr.21(-): 46934629-46954542 GRCh37]
XM_005261163.1 [Chr.21(-): 46934629-46983045 GRCh37]
XM_005261164.1 [Chr.21(-): 46934629-46962354 GRCh37]
ENST00000311124 [Chr.21(-): 46933690-46962385 GRCh37]
ENST00000380010 [Chr.21(-): 46934629-46962385 GRCh37]
ENST00000417954 [Chr.21(-): 46913486-46951455 GRCh37]
ENST00000427839 [Chr.21(-): 46951705-46961752 GRCh37]
ENST00000443742 [Chr.21(-): 46951788-46964314 GRCh37]
ENST00000460174 [Chr.21(-): 46932739-46935682 GRCh37]
ENST00000461785 [Chr.21(-): 46922427-46924035 GRCh37]
ENST00000468508 [Chr.21(-): 46932276-46935047 GRCh37]
ENST00000477688 [Chr.21(-): 46951332-46954620 GRCh37]
ENST00000485649 [Chr.21(-): 46935432-46954529 GRCh37]
ENST00000486303 [Chr.21(-): 46955898-46957847 GRCh37]
ENST00000528477 [Chr.21(-): 46957692-46964316 GRCh37]
ENST00000567670 [Chr.21(-): 46918115-46964325 GRCh37]
Annotation History:View Events (18)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC19A1.

Variant Data

View all PMT variants for SLC19A1 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC19A1 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC19A1 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
PromoterPDE
46962620 GRCh37
45787048 NCBI36
-235-4747
TGGCACCCCAGGATGCTGACGCCGG C → T GGGGGTGGGGGCCCGAGGGGCGGTC
- 
 
n=
C/C=
C/T=
T/T=
T=
136
68
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272
 PDE
46950914 GRCh37
45775342 NCBI36
  
CCCTGCCCCGTGGCCCCCCAGGGCC G → A CTGCAACGCCCCATCCCTCCCCTCT
- 
 
n=
G/G=
G/A=
A/A=
A=
160
79
1
0
0.006
158
79
0
0
0.000
118
59
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
46950899 GRCh37
45775327 NCBI36
  
CCCCAGGGCCGCTGCAACGCCCCAT C → T CCTCCCCTCTCAGGCGCCATCACGT
- 
 
n=
C/C=
C/T=
T/T=
T=
160
79
1
0
0.006
158
79
0
0
0.000
118
59
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 4: CodingPDE
46950863 GRCh37
45775291 NCBI36
1125972
CAGGCGCCATCACGTCCTTCGCCGC G → A GGCTTCGTGAAGATCCGCTGGGCGC
-324
Ala = Ala
n=
G/G=
G/A=
A/A=
A=
160
80
0
0
0.000
158
78
1
0
0.006
118
44
15
0
0.127
100
47
3
0
0.030
12
2
2
2
0.500
Set-II
Exon 4: CodingPDE
46950823 GRCh37
45775251 NCBI36
11651012
CCGCTGGGCGCGCTGGTCCAAGCTG C → T TCATCGCGGGCGTCACGGCCACGCA
-338
Leu → Phe
(D=22)
n=
C/C=
C/T=
T/T=
T=
160
79
1
0
0.006
158
79
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 4: CodingPDE
46950813 GRCh37
45775241 NCBI36
11751022
CGCTGGTCCAAGCTGCTCATCGCGG G → A CGTCACGGCCACGCAGGCGGGGCTG
-341
Gly → Asp
(D=94)
n=
G/G=
G/A=
A/A=
A=
160
80
0
0
0.000
158
78
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
46950676 GRCh37
45775104 NCBI36
  
CCTCGTGCCCATCGCCACGTGAGTT C → A CAGAAGGGTGGGAAGCCGGGGGCGG
- 
 
n=
C/C=
C/A=
A/A=
A=
160
79
1
0
0.006
158
79
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
46950622 GRCh37
45775050 NCBI36
  
GGCGCCAGGATCAAGCCCCGCGCTT C → T GCTGGGTGCTCCCACCTTCCTGCTG
- 
 
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
158
79
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
46950587 GRCh37
45775015 NCBI36
  
TCCCACCTTCCTGCTGCGCCCCAGC G → A GCTGTGCCACTGCTGGCCCCGCCAG
- 
 
n=
G/G=
G/A=
A/A=
A=
160
78
2
0
0.013
158
79
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
46950522 GRCh37
45774950 NCBI36
  
CCAGGGTCCCCACTTGCCTCTCCCT G → A GGACCTCGGGCGTCCCTTCCTGTGC
- 
 
n=
G/G=
G/A=
A/A=
A=
160
80
0
0
0.000
158
78
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
46950512 GRCh37
45774940 NCBI36
  
CACTTGCCTCTCCCTGGGACCTCGG G → A CGTCCCTTCCTGTGCCGTCTTGCTG
- 
 
n=
G/G=
G/A=
A/A=
A=
160
79
1
0
0.006
158
79
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
46950495 GRCh37
45774923 NCBI36
  
GACCTCGGGCGTCCCTTCCTGTGCC G → A TCTTGCTGCTCCCCCAGGCCCTCCA
- 
 
n=
G/G=
G/A=
A/A=
A=
160
80
0
0
0.000
158
79
0
0
0.000
120
59
1
0
0.008
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
 PDE
46945969 GRCh37
45770397 NCBI36
  
GCCCTGGGACCCCGTGGCTGCCGGG C → A GGGTCATGGGCTGGTGGGAGCCGGG
- 
 
n=
C/C=
C/A=
A/A=
A=
160
78
2
0
0.013
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
46945879 GRCh37
45770307 NCBI36
  
CAGCGCCTGATCTGCCCGCTCTTCC C → T GTTCAGCTTTCAGATTGCATCTTCT
- 
 
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
160
80
0
0
0.000
120
60
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
Exon 5: CodingPDE
46945782 GRCh37
45770210 NCBI36
13951242
TTGCCACCATCGTCAAGACCATCAT C → A ACTTTCATTGTCTCGGACGTGCGGG
-414
Ile = Ile
n=
C/C=
C/A=
A/A=
A=
160
77
3
0
0.019
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
46945709 GRCh37
45770137 NCBI36
  
GCAGGTGAGCCCATTTCAGGCCTGC G → A TCCTCGGGGATGGAAGCTACTTGTG
- 
 
n=
G/G=
G/A=
A/A=
A=
160
80
0
0
0.000
160
80
0
0
0.000
120
60
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
 PDE
46945615 GRCh37
45770043 NCBI36
  
CACTGTGGGCTGGGGGCACAGGGTG C → T GGGCCTGGGGCTTCCAGTGGGACAC
- 
 
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
160
80
0
0
0.000
120
52
8
0
0.067
100
50
0
0
0.000
12
5
1
0
0.083
Set-II
 PDE
46945582 GRCh37
45770010 NCBI36
  
GGGCTTCCAGTGGGACACACCAGGC C → T AGCGAGAGCAGGAAGTGAGAGAGAC
- 
 
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
160
80
0
0
0.000
120
60
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
Exon 6: CodingPDE
46935981 GRCh37
45760409 NCBI36
15201367
TTGGGGGCCATGCTGGATGGCCTGC G → A GCACTGCCAGCGGGGCCACCACCCG
-456
Arg → Gln
(D=43)
n=
G/G=
G/A=
A/A=
A=
160
80
0
0
0.000
160
80
0
0
0.000
120
58
2
0
0.017
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 6: CodingPDE
46935976 GRCh37
45760404 NCBI36
15251372
GGCCATGCTGGATGGCCTGCGGCAC T → G GCCAGCGGGGCCACCACCCGCGGCA
-458
Cys → Gly
(D=159)
n=
T/T=
T/G=
G/G=
G=
160
80
0
0
0.000
160
79
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 6: CodingPDE
46935956 GRCh37
45760384 NCBI36
15451392
GGCACTGCCAGCGGGGCCACCACCC G → A CGGCAGCCCCCGGCCCAGGGCCTGA
-464
Pro = Pro
n=
G/G=
G/A=
A/A=
A=
160
80
0
0
0.000
160
80
0
0
0.000
120
60
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
Exon 6: CodingPDE
46935942 GRCh37
45760370 NCBI36
15591406
GGCCACCACCCGCGGCAGCCCCCGG C → T CCAGGGCCTGAGGAGTGCCGCGGAG
-469
Ala → Val
(D=64)
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
Exon 6: CodingPDE
46935784 GRCh37
45760212 NCBI36
17171564
AGCCTCCCTGGAGCAGAGACAGAGC G → A ACCCATACCTGGCCCAGGCCCCGGC
-522
Asp → Asn
(D=23)
n=
G/G=
G/A=
A/A=
A=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 6: 3UTRPDE
46935540 GRCh37
45759968 NCBI36
1961 
GGCGCCCCTGTGGTAACTTTGCAGG C → T GGCCCTCAGTGCATCCCCACGACCC
- 
 
n=
C/C=
C/T=
T/T=
T=
160
78
2
0
0.013
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.