UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:TRMA
HGNC Symbol:SLC19A2
HGNC Description:solute carrier family 19 (thiamine transporter), member 2
HGNC ID:10938
Superfamily:SLC
Chromosome:Chr.1(-): 169433147-169455208 GRCh37
Location:1q23.3
OMIM:603941
OMIM Phenotype:Thiamine-responsive megaloblastic anemia syndrome
Accessions:NM_006996
Nucleotide RefSeq:NM_006996
Protein RefSeq:NP_008927
Entrez:10560
Ensembl:ENSG00000117479
Isoforms:2
Evidence:Substrate In Vitro Evidence: thiamine (Vitamin B1) 6 HeLa cells Substrate In Vivo Evidence: numerous mutations have been identified and are associated with TRMA 13 genotyping analysis in TRMA families 5 mutation analysis of TRMA affected individuals Tissue Distribution Evidence: ubiquitously expressed 13 Northern
Tissues:ubiquitously expressed
Type:protein-coding
Sets:V
PharmGKB ID:PA35825
HPRD ID:04897
Substrates:thiamine (Vitamin B1)
Trivial Names:TC1, THT1, TRMA, THMD1, THTR1
Transcripts:NM_006996.2 [Chr.1(-): 169433147-169455208 GRCh37]
XM_005244840.1 [Chr.1(-): 169433169-169455203 GRCh37]
ENST00000236137 [Chr.1(-): 169433147-169455241 GRCh37]
ENST00000367804 [Chr.1(-): 169433167-169455169 GRCh37]

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC19A2.

Variant Data

View all PMT variants for SLC19A2 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC19A2 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC19A2 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
169455576 GRCh37
167722200 NCBI36
-368-572
GTTTATCATTCTTATTCACCGTCTC C → T GGAATGTCCATTCAGTTTCCGCTCC
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
63
2
0
0.015
134
67
0
0
0.000
136
68
0
0
0.000
134
66
1
0
0.007
PMT-272
PromoterPDE
169455435 GRCh37
167722059 NCBI36
-227-431
GGCTTGCGGCGGAGCTCTCTCTAGT G → C AGGCGGCCAGCTGGCGTTCGTGGCA
+ 
 
n=
G/G=
G/C=
C/C=
C=
130
17
35
13
0.469
134
38
25
4
0.246
136
2
13
53
0.875
134
32
28
7
0.313
PMT-272
PromoterPDE
169455323 GRCh37
167721947 NCBI36
-115-319
TCCATTGGTCGTGGGTCACACGACG T → G GAACTGGGGCGGTGGCAGCACGCCA
+ 
 
n=
T/T=
T/G=
G/G=
G=
130
65
0
0
0.000
134
67
0
0
0.000
136
67
1
0
0.007
134
67
0
0
0.000
PMT-272
Exon 1: 5UTR
Promoter
PDE1 pub
169455200 GRCh37
167721824 NCBI36
9-196
ACGCCTCTAGGGTCGCTGCCTGATC G → T CCCAGTTTAAGGGAGACCCGTCCTA
+ 
 
n=
G/G=
G/T=
T/T=
T=
130
65
0
0
0.000
134
65
2
0
0.015
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
Exon 1: 5UTR
Promoter
PDE
169455199 GRCh37
167721823 NCBI36
10-195
GACGCCTCTAGGGTCGCTGCCTGAT C → G GCCCAGTTTAAGGGAGACCCGTCCT
+ 
 
n=
C/C=
C/G=
G/G=
G=
130
64
1
0
0.008
134
67
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.