UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:OCT1
HGNC Symbol:SLC22A1
HGNC Description:solute carrier family 22 (organic cation transporter), member 1
HGNC ID:10963
Superfamily:SLC
Chromosome:Chr.6(+): 160542821-160580147 GRCh37
Location:6q25.3
OMIM:602607
OMIM Phenotype:None
Accessions:U77086
Nucleotide RefSeq:NM_003057
Protein RefSeq:NP_003048
Entrez:6580
Ensembl:ENSG00000175003
Isoforms:6
Evidence:None
Tissues:liver (strong), heart, skeletal muscle, kidney, brain, intestine
Type:protein-coding
Sets:I,IV
PharmGKB ID:PA329
HPRD ID:04007
Substrates:TEA, MPP+, NMN, tributylmethylammonium, N-methylquinine, N-methylquinidine, azidoprocainamide methoiodide, prostaglandin E2, prostaglandin F2alpha, metformin
Trivial Names:OCT1, HOCT1, oct1_cds
Transcripts:NM_003057.2 [Chr.6(+): 160542863-160579750 GRCh37]
NM_153187.1 [Chr.6(+): 160542863-160579750 GRCh37]
XM_005267102.1 [Chr.6(+): 160542821-160580147 GRCh37]
XM_005267103.1 [Chr.6(+): 160542821-160579750 GRCh37]
XM_005267105.1 [Chr.6(+): 160543419-160580145 GRCh37]
XM_005267104.1 [Chr.6(+): 160545572-160580145 GRCh37]
ENST00000324965 [Chr.6(+): 160542968-160579583 GRCh37]
ENST00000366963 [Chr.6(+): 160542821-160579750 GRCh37]
ENST00000457470 [Chr.6(+): 160542968-160579614 GRCh37]
ENST00000460902 [Chr.6(+): 160542968-160579748 GRCh37]
ENST00000478607 [Chr.6(+): 160576986-160579750 GRCh37]
ENST00000539263 [Chr.6(+): 160542931-160579614 GRCh37]
ENST00000540443 [Chr.6(+): 160550793-160555039 GRCh37]
Annotation History:View Events (36)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC22A1.

Variant Data

View all PMT variants for SLC22A1 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC22A1 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC22A1 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
PromoterPDE
160542739 GRCh37
160462729 NCBI36
-124-229
GCTTAGACCCCACTGACTCGCTCCC G → A GGCAAAGCAAACGATTTGATCAGAT
+ 
 
n=
G/G=
G/A=
A/A=
A=
134
67
0
0
0.000
134
67
0
0
0.000
130
65
0
0
0.000
136
67
1
0
0.007
n/a
0.000
PMT-272
PromoterPDE
160542767 GRCh37
160462757 NCBI36
-96-201
CAAAGCAAACGATTTGATCAGATGG C → G CACGTGCATTCTTCCTTTTCCTGAA
+ 
 
n=
C/C=
C/G=
G/G=
G=
134
66
1
0
0.007
134
67
0
0
0.000
130
65
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272
PromoterPDEI
160542819 GRCh37
160462809 NCBI36
-44-149
CCAGCACCATAGGGTAAAAGATTAT T → C TCTACTTGGTTGCCTTCCAGATGTT
+ 
 
n=
T/T=
T/C=
C/C=
C=
134
61
5
1
0.052
134
67
0
0
0.000
130
65
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272
Exon 1: CodingPDE5 pubs
160543008 GRCh37
160462998 NCBI36
14641
GACATTCTGGAGCAGGTTGGGGAGT C → T TGGCTGGTTCCAGAAGCAAGCCTTC
+14
Ser → Phe
(D=155)
n=
C/C=
C/T=
T/T=
T=
196
93
4
1
0.031
192
96
0
0
0.000
60
30
0
0
0.000
18
9
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 1: CodingPDE
160543034 GRCh37
160463024 NCBI36
17267
TGGCTGGTTCCAGAAGCAAGCCTTC C → G TCATCTTATGCCTGCTGTCGGCTGC
+23
Leu → Val
(D=32)
n=
C/C=
C/G=
G/G=
G=
198
98
1
0
0.005
194
97
0
0
0.000
60
30
0
0
0.000
18
9
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 1: CodingPDE
160543080 GRCh37
160463070 NCBI36
218113
GCTGCCTTTGCGCCCATCTGTGTGG G → A CATCGTCTTCCTGGGTTTCACACCT
+38
Gly → Asp
(D=94)
n=
G/G=
G/A=
A/A=
A=
198
99
0
0
0.000
194
96
1
0
0.005
60
30
0
0
0.000
18
9
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 1: CodingPDEI
160543123 GRCh37
160463113 NCBI36
261156
TCACACCTGACCACCACTGCCAGAG T → C CCTGGGGTGGCTGAGCTGAGCCAGC
+52
Ser = Ser
n=
T/T=
T/C=
C/C=
C=
198
56
34
9
0.263
194
61
32
4
0.206
60
9
16
5
0.433
18
4
5
0
0.278
14
4
2
1
0.286
Set-I
Exon 1: CodingPDE19 pubs
160543148 GRCh37
160463138 NCBI36
286181
TCCTGGGGTGGCTGAGCTGAGCCAG C → T GCTGTGGCTGGAGCCCTGCGGAGGA
Reduced metformin and MPP+ uptake in transfected cells. PMID: 19940846.
+61
Arg → Cys
(D=180)
n=
C/C=
C/T=
T/T=
T=
198
99
0
0
0.000
194
83
14
0
0.072
60
30
0
0
0.000
18
8
1
0
0.056
14
7
0
0
0.000
Set-I
Exon 1: CodingPDE
160543220 GRCh37
160463210 NCBI36
358253
CCTGGGGCCCGCGGGCGAGGCCTTC C → T TTGGCCAGTGCAGGCGCTATGAAGT
+85
Leu → Phe
(D=22)
n=
C/C=
C/T=
T/T=
T=
198
97
2
0
0.010
194
97
0
0
0.000
60
30
0
0
0.000
18
9
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 2: CodingPDE9 pubsIA
160551204 GRCh37
160471194 NCBI36
585480
AGTCCTGTTTGAATGCGGGCTTCTT C → G TTTGGCTCTCTCGGTGTTGGCTACT
+160
Phe → Leu
(D=22)
n=
C/C=
C/G=
G/G=
G=
200
99
1
0
0.005
200
88
11
1
0.065
60
29
1
0
0.017
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
 PDE
160553238 GRCh37
160473228 NCBI36
  
CCCAGATTTCAACCTCTCCCACCTG C → T CCTCCATGTCTCCTTCTCTCTGAAG
+ 
 
n=
C/C=
C/T=
T/T=
T=
198
80
17
2
0.106
200
72
26
2
0.150
60
30
0
0
0.000
20
7
3
0
0.150
14
7
0
0
0.000
Set-I
Exon 3: CodingPDEI
160553306 GRCh37
160473296 NCBI36
663558
GTCTCCTGGGAACTGTGCTGGTCAA C → T GCGGTGTCGGGCGTGCTCATGGCCT
+186
Asn = Asn
n=
C/C=
C/T=
T/T=
T=
198
94
5
0
0.025
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 3: CodingPDE3 pubs
160553314 GRCh37
160473304 NCBI36
671566
GGAACTGTGCTGGTCAACGCGGTGT C → T GGGCGTGCTCATGGCCTTCTCGCCC
Reduced metformin uptake in transfected cells. PMID: 19940846.
+189
Ser → Leu
(D=145)
n=
C/C=
C/T=
T/T=
T=
198
99
0
0
0.000
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 3: CodingPDE5 pubs
160553407 GRCh37
160473397 NCBI36
764659
GTCAGCAAGGGCAACTGGATGGCTG G → T CTACACCCTAAGTAATTATCATGGG
Reduced metformin and MPP+ uptake in transfected cells. PMID: 19940846.
+220
Gly → Val
(D=109)
n=
G/G=
G/T=
T/T=
T=
198
98
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 4: CodingPDE
160555029 GRCh37
160475019 NCBI36
816711
GCTCGGGCTCCAGAAGAACGGTGGC G → A ATCATGTACCAGATGGCCTTCACGG
+237
Ala = Ala
n=
G/G=
G/A=
A/A=
A=
192
93
3
0
0.016
192
96
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 4: CodingPDE
160555086 GRCh37
160475076 NCBI36
873768
TGGTGGCGCTTACCGGGCTGGCCTA C → T GCCCTGCCTCACTGGCGCTGGCTGC
+256
Tyr = Tyr
n=
C/C=
C/T=
T/T=
T=
192
95
1
0
0.005
192
96
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
160557242 GRCh37
160477232 NCBI36
  
GGAAAATGCCAGATAGTGATGAGTG G → C TGTTCGCAGGTGTGTGCCGGAGTCC
+ 
 
n=
G/G=
G/C=
C/C=
C=
196
97
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
160557247 GRCh37
160477237 NCBI36
  
ATGCCAGATAGTGATGAGTGGTGTT C → T GCAGGTGTGTGCCGGAGTCCCCTCG
+ 
 
n=
C/C=
C/T=
T/T=
T=
196
98
0
0
0.000
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
160557408 GRCh37
160477398 NCBI36
  
GGTATCTCACATCACTGAATCTGGG G → C CTGGGTTCTGGTGCAGATTCGTCTG
+ 
 
n=
G/G=
G/C=
C/C=
C=
196
92
6
0
0.031
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
160557429 GRCh37
160477419 NCBI36
  
TGGGGCTGGGTTCTGGTGCAGATTC G → A TCTGGGGCTGCCAGGGGAAAGAGCA
+ 
 
n=
G/G=
G/A=
A/A=
A=
196
98
0
0
0.000
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 PDE
160557459 GRCh37
160477449 NCBI36
  
GGGCTGCCAGGGGAAAGAGCAGAAC T → C GTGCCCCTTGTCATGGGTGTGAAGC
+ 
 
n=
T/T=
T/C=
C/C=
C=
196
97
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
160557487 GRCh37
160477477 NCBI36
  
GCCCCTTGTCATGGGTGTGAAGCAC G → A GTGGTGGCAAGGCTCACCTCCCCAG
+ 
 
n=
G/G=
G/A=
A/A=
A=
196
98
0
0
0.000
200
100
0
0
0.000
60
29
1
0
0.017
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
160557515 GRCh37
160477505 NCBI36
  
GGTGGCAAGGCTCACCTCCCCAGGG G → A CTCCCAGGTGGCTCTGCTCATGACA
+ 
 
n=
G/G=
G/A=
A/A=
A=
196
83
15
0
0.077
200
100
0
0
0.000
60
24
5
1
0.117
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
160557569 GRCh37
160477559 NCBI36
  
TGAGTGTGGCTGATGCTCTCCCTCC C → T TCCTAGATGCTTTCCCTCGAAGAGG
+ 
 
n=
C/C=
C/T=
T/T=
T=
196
81
15
2
0.097
200
70
28
2
0.160
60
30
0
0
0.000
20
7
3
0
0.150
14
7
0
0
0.000
Set-I
Exon 6: CodingPDE11 pubsI
160557643 GRCh37
160477633 NCBI36
11271022
TCATTTGCAGACCTGTTCCGCACGC C → T GCGCCTGAGGAAGCGCACCTTCATC
Reduced MPP+ uptake in oocytes. PMID: 19940846.
+341
Pro → Leu
(D=98)
n=
C/C=
C/T=
T/T=
T=
196
82
16
0
0.082
200
100
0
0
0.000
60
24
5
1
0.117
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 6: CodingPDE1 pub
160557646 GRCh37
160477636 NCBI36
11301025
TTTGCAGACCTGTTCCGCACGCCGC G → A CCTGAGGAAGCGCACCTTCATCCTG
+342
Arg → His
(D=29)
n=
G/G=
G/A=
A/A=
A=
196
93
4
1
0.031
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
160557704 GRCh37
160477694 NCBI36
  
TGTGGTGAGGGGCGTTCCTGTGCGT C → T TCTCCAGGCAGAATCAGCACGCTCG
+ 
 
n=
C/C=
C/T=
T/T=
T=
196
96
2
0
0.010
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
160557728 GRCh37
160477718 NCBI36
  
TCTCTCCAGGCAGAATCAGCACGCT C → T GCCCAAGCACTGGGCTATAGATTAG
+ 
 
n=
C/C=
C/T=
T/T=
T=
194
96
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
Exon 7: CodingPDE11 pubs
160560824 GRCh37
160480814 NCBI36
13061201
AGCCCTCATCACCATTGACCGCGTG G → A GCCGCATCTACCCCATGGCCATGTC
Reduced metformin and MPP+ uptake in transfected cells. PMID: 19940846.
+401
Gly → Ser
(D=56)
n=
G/G=
G/A=
A/A=
A=
136
67
1
0
0.007
184
90
2
0
0.011
42
21
0
0
0.000
14
7
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 7: CodingPDE
160560832 GRCh37
160480822 NCBI36
13141209
TCACCATTGACCGCGTGGGCCGCAT C → T TACCCCATGGCCATGTCAAATTTGT
+403
Ile = Ile
n=
C/C=
C/T=
T/T=
T=
136
67
1
0
0.007
184
92
0
0
0.000
42
21
0
0
0.000
14
7
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 7: CodingPDE11 pubsI
160560845 GRCh37
160480835 NCBI36
13271222
CGTGGGCCGCATCTACCCCATGGCC A → G TGTCAAATTTGTTGGCGGGGGCAGC
+408
Met → Val
(D=21)
n=
A/A=
A/G=
G/G=
G=
136
4
28
36
0.735
184
15
44
33
0.598
42
2
6
13
0.762
14
0
3
4
0.786
14
0
1
6
0.929
Set-I
Exon 7: CodingPDE
160560862 GRCh37
160480852 NCBI36
13441239
CCATGGCCATGTCAAATTTGTTGGC G → A GGGGCAGCCTGCCTCGTCATGATTT
+413
Ala = Ala
n=
G/G=
G/A=
A/A=
A=
136
64
4
0
0.029
184
92
0
0
0.000
42
21
0
0
0.000
14
7
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 7: Coding4 pubs
160560881 GRCh37
160480871 NCBI36
13631258
GTTGGCGGGGGCAGCCTGCCTCGTC A → - TGATTTTTATCTCACCTGGTAAGTT
Reduced metformin uptake in transfected cells. PMID: 19940846.
+420
Met → DEL
n=
A/A=
A/-=
-/-=
-=
136
64
4
0
0.029
184
60
30
2
0.185
42
21
0
0
0.000
14
5
1
1
0.214
14
7
0
0
0.000
Set-I
Exon 7: CodingPDE4 pubs
160560882 GRCh37
160480872 NCBI36
13641259
TTGGCGGGGGCAGCCTGCCTCGTCA T → - GATTTTTATCTCACCTGGTAAGTTG
Reduced metformin uptake in transfected cells. PMID: 19940846.
+420
Met → DEL
n=
T/T=
T/-=
-/-=
-=
136
64
4
0
0.029
184
60
30
2
0.185
42
21
0
0
0.000
14
5
1
1
0.214
14
7
0
0
0.000
Set-I
Exon 7: CodingPDE5 pubs
160560883 GRCh37
160480873 NCBI36
13651260
TGGCGGGGGCAGCCTGCCTCGTCAT G → - ATTTTTATCTCACCTGGTAAGTTGG
Reduced metformin uptake in transfected cells. PMID: 19940846.
+420
Met → DEL
n=
G/G=
G/-=
-/-=
-=
136
64
4
0
0.029
184
60
30
2
0.185
42
21
0
0
0.000
14
5
1
1
0.214
14
7
0
0
0.000
Set-I
 1 pub
160560908 GRCh37
160480898 NCBI36
  
GATTTTTATCTCACCTGGTAAGTTG G → - TAAGTTGTCTGCTTTCATCATTTCC
+ 
 
n=
G/G=
G/-=
-/-=
-=
128
1
26
37
0.781
172
14
43
29
0.587
40
2
6
12
0.750
14
0
3
4
0.786
14
0
2
5
0.857
Set-I
 PDE
160560909 GRCh37
160480899 NCBI36
  
ATTTTTATCTCACCTGGTAAGTTGG T → - AAGTTGTCTGCTTTCATCATTTCCC
+ 
 
n=
T/T=
T/-=
-/-=
-=
128
1
26
37
0.781
172
14
43
29
0.587
40
2
6
12
0.750
14
0
3
4
0.786
14
0
2
5
0.857
Set-I
 PDE
160560910 GRCh37
160480900 NCBI36
  
TTTTTATCTCACCTGGTAAGTTGGT A → - AGTTGTCTGCTTTCATCATTTCCCA
+ 
 
n=
A/A=
A/-=
-/-=
-=
128
1
26
37
0.781
172
14
43
29
0.587
40
2
6
12
0.750
14
0
3
4
0.786
14
0
2
5
0.857
Set-I
 PDE
160560911 GRCh37
160480901 NCBI36
  
TTTTATCTCACCTGGTAAGTTGGTA A → - GTTGTCTGCTTTCATCATTTCCCAG
+ 
 
n=
A/A=
A/-=
-/-=
-=
128
1
26
37
0.781
172
14
43
29
0.587
40
2
6
12
0.750
14
0
3
4
0.786
14
0
2
5
0.857
Set-I
 PDE
160560912 GRCh37
160480902 NCBI36
  
TTTATCTCACCTGGTAAGTTGGTAA G → - TTGTCTGCTTTCATCATTTCCCAGG
+ 
 
n=
G/G=
G/-=
-/-=
-=
128
1
26
37
0.781
172
14
43
29
0.587
40
2
6
12
0.750
14
0
3
4
0.786
14
0
2
5
0.857
Set-I
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 PDE
160560913 GRCh37
160480903 NCBI36
  
TTATCTCACCTGGTAAGTTGGTAAG T → - TGTCTGCTTTCATCATTTCCCAGGC
+ 
 
n=
T/T=
T/-=
-/-=
-=
128
1
26
37
0.781
172
14
43
29
0.587
40
2
6
12
0.750
14
0
3
4
0.786
14
0
2
5
0.857
Set-I
 PDE
160560914 GRCh37
160480904 NCBI36
  
TATCTCACCTGGTAAGTTGGTAAGT T → - GTCTGCTTTCATCATTTCCCAGGCA
+ 
 
n=
T/T=
T/-=
-/-=
-=
128
1
26
37
0.781
172
14
43
29
0.587
40
2
6
12
0.750
14
0
3
4
0.786
14
0
2
5
0.857
Set-I
 
160560915 GRCh37
160480905 NCBI36
  
ATCTCACCTGGTAAGTTGGTAAGTT G → - TCTGCTTTCATCATTTCCCAGGCAA
+ 
 
n=
G/G=
G/-=
-/-=
-=
128
1
26
37
0.781
172
14
43
29
0.587
40
2
6
12
0.750
14
0
3
4
0.786
14
0
2
5
0.857
Set-I
 PDEI
160560933 GRCh37
160480923 NCBI36
  
GTAAGTTGTCTGCTTTCATCATTTC C → T CAGGCAATCGAAGTGTGGGGAAAGT
+ 
 
n=
C/C=
C/T=
T/T=
T=
70
24
10
1
0.171
60
22
7
1
0.150
28
14
0
0
0.000
8
3
1
0
0.125
10
5
0
0
0.000
Set-I
Exon 8: CodingPDE2 pubs
160564616 GRCh37
160484606 NCBI36
14251320
TCATAATCATGTGTGTTGGCCGAAT G → A GGAATCACCATTGCAATACAAATGA
+440
Met → Ile
(D=10)
n=
G/G=
G/A=
A/A=
A=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 8: CodingPDE
160564677 GRCh37
160484667 NCBI36
14861381
GAATGCTGAGCTGTACCCCACATTC G → A TCAGGTGAGTGCATGGAACAGGGGT
+461
Val → Ile
(D=29)
n=
G/G=
G/A=
A/A=
A=
200
98
2
0
0.010
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 9: CodingPDE12 pubs
160575837 GRCh37
160495827 NCBI36
14981393
TCCTTTGTATTTTATCAGGAACCTC G → A GAGTGATGGTGTGTTCCTCCCTGTG
Reduced metformin and MPP+ uptake in transfected cells. PMID: 19940846.
+465
Gly → Arg
(D=125)
n=
G/G=
G/A=
A/A=
A=
200
100
0
0
0.000
200
92
8
0
0.040
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 9: CodingPDE1 pub
160575907 GRCh37
160495897 NCBI36
15681463
ACCCCCTTCATAGTCTTCAGGCTGA G → T GGAGGTCTGGCAAGCCTTGCCCCTC
+488
Arg → Met
(D=91)
n=
G/G=
G/T=
T/T=
T=
200
91
8
1
0.050
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
160575957 GRCh37
160495947 NCBI36
  
CATTTTGTTTGGTAAGATTTTGTGG A → C GCATATATCATTCCTTCTTTTGCAG
+ 
 
n=
A/A=
A/C=
C/C=
C=
200
91
8
1
0.050
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
160575979 GRCh37
160495969 NCBI36
  
TGGAGCATATATCATTCCTTCTTTT G → T CAGCTCGGCAGTGGGCTCAGCATGG
+ 
 
n=
G/G=
G/T=
T/T=
T=
200
91
9
0
0.045
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDEI
160575985 GRCh37
160495975 NCBI36
  
ATATATCATTCCTTCTTTTGCAGCT C → T GGCAGTGGGCTCAGCATGGGTGGAA
+ 
 
n=
C/C=
C/T=
T/T=
T=
200
71
16
13
0.210
200
77
16
7
0.150
60
27
1
2
0.083
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
 PDEI
160579527 GRCh37
160499517 NCBI36
  
GCTTATTTATTTATTTTAACTCCAA C → T TTTTAATTTTGTTGTTACAGAAAAG
+ 
 
n=
C/C=
C/T=
T/T=
T=
200
53
39
8
0.275
198
59
36
4
0.222
60
8
16
6
0.467
20
8
2
0
0.100
14
2
4
1
0.429
Set-I
Exon 11: CodingPDEI
160579596 GRCh37
160499586 NCBI36
17521647
CGATTTACCTTAAGGTCCAAACCTC A → C GAACCCTCGGGCACCTGAGAGAGAT
+549
Ser = Ser
n=
A/A=
A/C=
C/C=
C=
200
93
7
0
0.035
198
99
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 11: 3UTRPDEI
160579629 GRCh37
160499619 NCBI36
1785 
CGGGCACCTGAGAGAGATGTTTTGC G → A GCGATGTCGTGTTGGAGGGATGAAG
+ 
 
n=
G/G=
G/A=
A/A=
A=
200
96
4
0
0.020
198
99
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 11: 3UTRPDEI
160579637 GRCh37
160499627 NCBI36
1793 
TGAGAGAGATGTTTTGCGGCGATGT C → T GTGTTGGAGGGATGAAGATGGAGTT
+ 
 
n=
C/C=
C/T=
T/T=
T=
200
100
0
0
0.000
198
99
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
6
1
0
0.071
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.