UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:None
HGNC Symbol:SLC22A10
HGNC Description:solute carrier family 22, member 10
HGNC ID:18057
Superfamily:SLC
Chromosome:Chr.11(+): 63057372-63079246 GRCh37
Location:11q12.3
OMIM:607580
OMIM Phenotype:None
Accessions:None
Nucleotide RefSeq:NM_001039752
Protein RefSeq:NP_001034841
Entrez:387775
Ensembl:ENSG00000184999
Isoforms:2
Evidence:None
Tissues:Liver
Type:protein-coding
Sets:None
PharmGKB ID:PA38283
HPRD ID:
Substrates:No data
Trivial Names:OAT5, hOAT5
Transcripts:NM_001039752.3 [Chr.11(+): 63057430-63079246 GRCh37]
XM_005273986.1 [Chr.11(+): 63057392-63078584 GRCh37]
ENST00000332793 [Chr.11(+): 63057636-63078904 GRCh37]
ENST00000525620 [Chr.11(+): 62905339-63137190 GRCh37]
ENST00000526800 [Chr.11(+): 63057780-63078573 GRCh37]
ENST00000532724 [Chr.11(+): 63057771-63072223 GRCh37]
ENST00000533176 [Chr.11(+): 63057564-63059094 GRCh37]
ENST00000533483 [Chr.11(+): 63057372-63079243 GRCh37]
ENST00000535888 [Chr.11(+): 62921972-63137190 GRCh37]
ENST00000544661 [Chr.11(+): 63057419-63079237 GRCh37]
Annotation History:View Events (10)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC22A10.

Variant Data

View all PMT variants for SLC22A10 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC22A10 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC22A10 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
PromoterPDE
63057347 GRCh37
62813923 NCBI36
-83-291
GAGTCACTTGAGGACAAACATATTT G → A GAGAGAGTAAACCTTTAAACGGATT
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
62
6
0
0.044
130
64
1
0
0.008
134
67
0
0
0.000
134
66
1
0
0.007
PMT-272
PromoterPDE
63057429 GRCh37
62814005 NCBI36
-1-209
AATAATGATCTCTATGACTACAAAA T → C AACATCTACCTCCTGATAGCAAAAG
+ 
 
n=
T/T=
T/C=
C/C=
C=
136
68
0
0
0.000
130
65
0
0
0.000
134
67
0
0
0.000
134
66
1
0
0.007
PMT-272
Promoter
Exon 1: 5UTR
PDE
63057438 GRCh37
62814014 NCBI36
9-200
CTCTATGACTACAAAATAACATCTA C → A CTCCTGATAGCAAAAGAACTGAGGA
+ 
 
n=
C/C=
C/A=
A/A=
A=
136
68
0
0
0.000
130
65
0
0
0.000
134
66
1
0
0.007
134
67
0
0
0.000
PMT-272
Promoter
Exon 1: 5UTR
PDE
63057440 GRCh37
62814016 NCBI36
11-198
CTATGACTACAAAATAACATCTACC T → C CCTGATAGCAAAAGAACTGAGGAAG
+ 
 
n=
T/T=
T/C=
C/C=
C=
136
67
1
0
0.007
130
58
7
0
0.054
134
67
0
0
0.000
134
64
2
1
0.030
PMT-272
Exon 1: 5UTRPDE
63057492 GRCh37
62814068 NCBI36
63-146
TCTTTCCACTACGGCTGTATTGCAC T → G GGTGAGTCCGGGCCCATGGATGAGA
+ 
 
n=
T/T=
T/G=
G/G=
G=
136
68
0
0
0.000
130
64
1
0
0.008
134
67
0
0
0.000
134
67
0
0
0.000
PMT-272
 PDE
63078473 GRCh37
62835049 NCBI36
  
TTATTGTTTCTGTTTTGTTTTGTTT T → TGTTTT TCCAGAAAAAAAAATCTCAAGGAAA
+ 
 
n=
T/T=
T/TGTTTT=
TGTTTT/TGTTTT=
TGTTTT=
136
68
0
0
0.000
136
67
1
0
0.007
130
65
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 10: Coding
63078487 GRCh37
62835063 NCBI36
18151607
TTGTTTTGTTTTTCCAGAAAAAAAA A → - TCTCAAGGAAAAGGCATAAAAATGA
+536
Asn → DEL
n=
A/A=
A/-=
-/-=
-=
136
62
6
0
0.044
136
67
1
0
0.007
130
65
0
0
0.000
136
67
1
0
0.007
PMT-272
Exon 10: 3UTRPDE
63078575 GRCh37
62835151 NCBI36
1903 
ATGAGCTGATTGGTGGGGAAATTCA G → GA AAAAAAAAATACAGGAAAAGAACAC
+ 
 
n=
G/G=
G/GA=
GA/GA=
GA=
136
68
0
0
0.000
136
68
0
0
0.000
130
56
9
0
0.069
136
67
1
0
0.007
PMT-272
Exon 10: 3UTRPDE
63078610 GRCh37
62835186 NCBI36
1938 
TACAGGAAAAGAACACACCAGAAGG G → GT TTTTTTTCCCTACAACCAGCAAGAA
+ 
 
n=
G/G=
G/GT=
GT/GT=
GT=
136
68
0
0
0.000
136
68
0
0
0.000
132
57
9
0
0.068
136
68
0
0
0.000
PMT-272
Exon 10: 3UTRPDE
63078690 GRCh37
62835266 NCBI36
2018 
AATTATGGCATTAATTTGCATTTTA T → G TTCAAAATTAACTTGTGGGGACATG
+ 
 
n=
T/T=
T/G=
G/G=
G=
136
67
1
0
0.007
136
68
0
0
0.000
132
66
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 10: 3UTRPDEIA
63078986 GRCh37
62835562 NCBI36
2314 
ATGATACTTTTGACATAATAAGCCA T → C TGGAAAACGGAAAGATTAGATACTA
+ 
 
n=
T/T=
T/C=
C/C=
C=
136
40
22
6
0.250
136
13
27
28
0.610
136
22
34
12
0.426
136
21
29
18
0.478
PMT-272
Exon 10: 3UTRPDE
63078994 GRCh37
62835570 NCBI36
2322 
TTTGACATAATAAGCCATTGGAAAA C → T GGAAAGATTAGATACTAAATAACAT
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
67
1
0
0.007
136
67
1
0
0.007
136
67
1
0
0.007
136
68
0
0
0.000
PMT-272
Exon 10: 3UTRPDE
63079075 GRCh37
62835651 NCBI36
2403 
ATGATGTTAGTTACTTTTCCATGGT G → A GAATTTTAATTACTTTTTCTTTGTA
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
PMT-272
Exon 10: 3UTR
63079106 GRCh37
62835682 NCBI36
2434 
TTAATTACTTTTTCTTTGTAATTTT T → - CTCTCTGTATATTTTAAACAAATAG
+ 
 
n=
T/T=
T/-=
-/-=
-=
136
3
27
38
0.757
136
9
23
36
0.699
136
21
35
12
0.434
136
18
25
25
0.551
PMT-272
Exon 10: 3UTRPDE
63079161 GRCh37
62835737 NCBI36
2489 
TATAGTTTACAATATTATAAAGATA T → C TGTTCAAATTGAAGGGCAAAGGCCA
+ 
 
n=
T/T=
T/C=
C/C=
C=
134
61
6
0
0.045
136
67
1
0
0.007
136
68
0
0
0.000
136
67
1
0
0.007
PMT-272
Exon 10: 3UTRPDE
63079162 GRCh37
62835738 NCBI36
2490 
ATAGTTTACAATATTATAAAGATAT T → C GTTCAAATTGAAGGGCAAAGGCCAG
+ 
 
n=
T/T=
T/C=
C/C=
C=
134
66
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
 PDE
63079274 GRCh37
62835850 NCBI36
  
TTTCAAATGATGTGACTAATAAATG A → T AAGTACATATAGTAGTAAAGTAATT
+ 
 
n=
A/A=
A/T=
T/T=
T=
134
65
2
0
0.015
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
 PDE
63079345 GRCh37
62835921 NCBI36
  
AAAATATAAACTTTCATTTTAAACA G → A CAAAGATTTTAAGTGCTAATGATTC
+ 
 
n=
G/G=
G/A=
A/A=
A=
134
66
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.