UCSF Pharmacogenetics of Membrane Transporters
Gene View
PMT Study Investigator:Dr. Kathleen Giacomini
Common Name:OAT4
HGNC Symbol:SLC22A11
HGNC Description:solute carrier family 22 (organic anion/urate transporter), member 11
HGNC ID:18120
Superfamily:SLC
Chromosome:Chr.11(+): 64323098-64339002 GRCh37
Location:11q13.1
OMIM:607097
OMIM Phenotype:None
Accessions:NM_018484
Nucleotide RefSeq:NM_018484
Protein RefSeq:NP_060954
Entrez:55867
Ensembl:ENSG00000168065
Isoforms:2
Evidence:None
Tissues:placenta, kidney
Type:protein-coding
Sets:IV
PharmGKB ID:PA38295
HPRD ID:06161
Substrates:estrone sulfate, dehydroepiandrosterone sulfate (DHEA-S), ochratoxin A, tatracycline, prostaglandin E2, prostaglandin F2alpha
Trivial Names:OAT4, hOAT4
Transcripts:NM_018484.2 [Chr.11(+): 64323098-64338999 GRCh37]
XM_005274098.1 [Chr.11(+): 64323115-64339002 GRCh37]
ENST00000301891 [Chr.11(+): 64323098-64340347 GRCh37]
ENST00000377581 [Chr.11(+): 64323428-64338999 GRCh37]
ENST00000377585 [Chr.11(+): 64323162-64338999 GRCh37]
ENST00000416590 [Chr.11(+): 64335072-64338999 GRCh37]
ENST00000428570 [Chr.11(+): 64335071-64338999 GRCh37]
ENST00000460745 [Chr.11(+): 64329554-64334171 GRCh37]
ENST00000478051 [Chr.11(+): 64323439-64333755 GRCh37]
ENST00000490834 [Chr.11(+): 64323439-64332837 GRCh37]
Annotation History:View Events (10)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC22A11.

Variant Data

View all PMT variants for SLC22A11 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC22A11 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC22A11 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
PromoterPDE
64322891 GRCh37
64079467 NCBI36
-207-581
CGTTTTCTGATTTAAAGGGCCTCGC G → C TAGAAGGTTCTAAAGATTTAAGAAT
+ 
 
n=
G/G=
G/C=
C/C=
C=
134
46
19
2
0.172
128
64
0
0
0.000
128
59
5
0
0.039
106
50
3
0
0.028
PMT-272
PromoterPDE
64323005 GRCh37
64079581 NCBI36
-93-467
CACTCAGAAGCCCACGCTGAGATTA A → G ACTTTAACCAACTCAGTGAGGCAAC
+ 
 
n=
A/A=
A/G=
G/G=
G=
134
60
7
0
0.052
128
63
1
0
0.008
128
64
0
0
0.000
106
52
1
0
0.009
PMT-272
PromoterPDEI
64323080 GRCh37
64079656 NCBI36
-18-392
CTGTAATTCAGTAACATCAAAGCAC C → T CTGTCTTTTTAAATAGAATCTGCCT
+ 
 
n=
C/C=
C/T=
T/T=
T=
134
30
27
10
0.351
128
13
38
13
0.500
128
58
6
0
0.047
106
19
27
7
0.387
PMT-272
Promoter
Exon 1: 5UTR
PDE
64323104 GRCh37
64079680 NCBI36
7-368
CCCTGTCTTTTTAAATAGAATCTGC CTGA → - CTTTCACTTTTGGTGCTGGAGA
+ 
 
n=
CTGA/CTGA=
CTGA/-=
-/-=
-=
134
67
0
0
0.000
128
64
0
0
0.000
128
64
0
0
0.000
108
53
1
0
0.009
PMT-272
Exon 1: 5UTRPDE
64323228 GRCh37
64079804 NCBI36
131-244
TGAGCTTAGTCCCCTTCACCCCCTC C → T GCAGAGCTCTGGGGCATCCGCACAG
+ 
 
T=
0.000
0.000
0.007
0.000
PMT-272
Exon 1: 5UTRPDE
64323433 GRCh37
64080009 NCBI36
336-39
TGGCTGCAATCGGTTCCAAACAGCA G → A TTAGGTCAGCAGTCCGCTCAGCCGA
+ 
 
A=
0.000
0.000
0.007
0.008
PMT-272
Exon 1: CodingPDE
64323507 GRCh37
64080083 NCBI36
41036
CGAAGCTCTTGGAGCAAGCCGGAGG C → T GTGGGCCTCTTCCAGACCCTGCAGG
+12
Gly = Gly
T=
0.015
0.000
0.000
0.000
PMT-272
Exon 1: CodingPDE
64323534 GRCh37
64080110 NCBI36
43763
TGGGCCTCTTCCAGACCCTGCAGGT G → A CTCACCTTCATCCTCCCCTGCCTCA
+21
Val = Val
A=
0.000
0.000
0.000
0.008
PMT-272
Exon 1: CodingPDE
64323613 GRCh37
64080189 NCBI36
516142
CTTCTCAGCCGCCATCCCAGGCCAC C → T GATGCTGGACACACATGCTGGACAA
Drastically reduced uptake of estrone sulfate, ochratoxin A, and uric acid in transfected cells. Significantly lower mRNA levels in stably transfected HEK-293-Flp cells. PMID: 20668102.
+48
Arg → STOP
T=
0.000
0.023
0.000
0.008
PMT-272
Exon 1: CodingPDE
64323783 GRCh37
64080359 NCBI36
686312
TGGACCCCAATGCCACGGCCACCAG C → T TGGAGCGAAGCTGACACGGAGCCGT
+104
Ser = Ser
T=
0.000
0.000
0.051
0.000
PMT-272
Exon 1: CodingPDE1 pub
64323832 GRCh37
64080408 NCBI36
735361
GTGTGTGGACGGCTGGGTCTATGAC C → T GCAGCGTCTTCACCTCCACCATCGT
Altered kinetics of estrone sulfate in transfected cells. PMID: 20668102.
+121
Arg → Cys
(D=180)
T=
0.023
0.000
0.000
0.000
PMT-272
 PDE
64323877 GRCh37
64080453 NCBI36
  
CATCGTGGCCAAGGTAGGGCCTCCC C → A CAGAGCCACTCGAGTCCCGTCACCT
+ 
 
A=
0.015
0.000
0.000
0.000
PMT-272
Exon 2: CodingPDE1 pub
64326676 GRCh37
64083252 NCBI36
837463
GTCCATCTTCATGTCCGGGATCCTG G → A TGGGCTCCTTTATCTGGGGCCTCCT
Altered kinetics of estrone sulfate in transfected cells. PMID: 20668102.
+155
Val → Met
(D=21)
A=
0.015
0.000
0.000
0.000
PMT-272
Exon 2: CodingPDE1 pub
64326677 GRCh37
64083253 NCBI36
838464
TCCATCTTCATGTCCGGGATCCTGG T → G GGGCTCCTTTATCTGGGGCCTCCTC
Altered kinetics of estrone sulfate in transfected cells. PMID: 20668102.
+155
Val → Gly
(D=109)
G=
0.000
0.000
0.000
0.007
PMT-272
Exon 2: CodingPDE1 pub
64326696 GRCh37
64083272 NCBI36
857483
TCCTGGTGGGCTCCTTTATCTGGGG C → A CTCCTCTCCTACCGGTGAGTGCCTC
+161
Gly = Gly
A=
0.029
0.000
0.053
0.037
PMT-272
 PDE
64326795 GRCh37
64083371 NCBI36
  
GGCAGAAGGTTCAGAAATGTCAGGC A → G AACACCCCATCCCTGCTTCCGTCTC
+ 
 
G=
0.662
0.469
0.038
0.346
PMT-272
 PDE
64329649 GRCh37
64086225 NCBI36
  
ACACTGAGTGAGTCCCCGGCTCAGC G → A CGCTCCTGCCATGGGGGCGGGGGTG
+ 
 
A=
0.007
0.000
0.000
0.000
PMT-272
Exon 4: CodingPDE
64329770 GRCh37
64086346 NCBI36
1058684
AGTGGACCACGACCAGCAGGAGGGC G → C GTCACCATGACGGTGGTGGGATGTG
+228
Ala = Ala
C=
0.000
0.008
0.000
0.000
PMT-272
Exon 6: CodingPDE
64332779 GRCh37
64089355 NCBI36
14021028
GACCTGTTCTGCGTGCCCGTGCTCC G → T CTGGAGGAGCTGCGCCATGCTGGTG
+343
Arg → Leu
(D=102)
T=
0.000
0.000
0.000
0.007
PMT-272
 PDE
64332862 GRCh37
64089438 NCBI36
  
GGCAGGGCTGGGACAGGCAGGAGGC A → C GAGCTGGGACAGGCAGGAGGCAGAG
+ 
 
C=
0.147
0.493
0.015
0.353
PMT-272
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
64332891 GRCh37
64089467 NCBI36
  
CTGGGACAGGCAGGAGGCAGAGCGT C → G CAGGGGAAACAGCACCCGCAGGCCT
+ 
 
G=
0.015
0.000
0.000
0.000
PMT-272
 PDE
64335035 GRCh37
64091611 NCBI36
  
TTGCTGTTGGGGTGCCCTCTCCCCG G → A CAGGGCAGGGACCTGACTTCCAGCC
+ 
 
A=
0.066
0.000
0.000
0.008
PMT-272
 PDE
64336315 GRCh37
64092891 NCBI36
  
CCGTCCTGAGAGGGCGGTGGGAAGG G → GT AAAGAAGGGTCTGGCAGCCAGGGAA
+ 
 
GT=
0.228
0.008
0.000
0.015
PMT-272
 PDE
64336370 GRCh37
64092946 NCBI36
  
AGCCAGGGCCGCTCAGGGTCCCCCC C → A AGGACAGCTCTTCCCCTTGAGAGTC
+ 
 
A=
0.000
0.008
0.000
0.000
PMT-272
Exon 9: CodingPDE1 pub
64337147 GRCh37
64093723 NCBI36
17801406
AGGATGACAGCAGATGGCATTCTGC A → G TACAGTGGGCCGGCTGGGGGCTATG
Drastically reduced uptake of estrone sulfate, ochratoxin A, and uric acid in transfected cells. PMID: 20668102.
+469
His → Arg
(D=29)
G=
0.000
0.008
0.000
0.000
PMT-272
Exon 9: CodingPDE
64337212 GRCh37
64093788 NCBI36
18451471
CCTGATGAGCCGCCAAGCCCTGCCC C → G TGCTGCCTCCTCTCCTCTATGGCGT
+491
Leu → Val
(D=32)
G=
0.000
0.000
0.000
0.007
PMT-272
Exon 9: CodingPDE
64337280 GRCh37
64093856 NCBI36
19131539
GCCTGGTTGTGCTGTTCTTCCTCCC G → A GAGACCCAGGGACTTCCGCTCCCTG
+513
Pro = Pro
A=
0.000
0.000
0.000
0.015
PMT-272
Exon 10: 3UTRPDEI
64338586 GRCh37
64095162 NCBI36
2099 
GAGTTGCCTCTTCTCCAATCAGAGC G → A TGGAGGCGAGTTGGGCGACTTCAAG
+ 
 
A=
0.324
0.015
0.000
0.015
PMT-272
Exon 10: 3UTRPDE
64338646 GRCh37
64095222 NCBI36
2159 
TGGCAGAGGCCAGGCAGCCGTGGCC G → A AGTGGACAGCGTGGCCGTCTGCTGT
+ 
 
A=
0.000
0.000
0.000
0.008
PMT-272
Exon 10: 3UTRPDE
64338662 GRCh37
64095238 NCBI36
2175 
GCCGTGGCCGAGTGGACAGCGTGGC C → T GTCTGCTGTGGCTGAAGGCAGCTTC
+ 
 
T=
0.000
0.008
0.000
0.000
PMT-272
Exon 10: 3UTRPDE
64338715 GRCh37
64095291 NCBI36
2228 
CAGCTCACTCCTCTTCTCCCTGCCC T → C GATCAGATTCCCCACCTTACCCGGG
+ 
 
C=
0.015
0.000
0.000
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.