UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:OAT4L
HGNC Symbol:SLC22A12
HGNC Description:solute carrier family 22 (organic anion/urate transporter), member 12
HGNC ID:17989
Superfamily:SLC
Chromosome:Chr.11(+): 64358113-64369825 GRCh37
Location:11q13.1
OMIM:607096
OMIM Phenotype:Renal hypouricemia
Accessions:NM_144585
Nucleotide RefSeq:NM_144585
Protein RefSeq:NP_653186
Entrez:116085
Ensembl:ENSG00000197891
Isoforms:12
Evidence:None
Tissues:kidney
Type:protein-coding
Sets:V
PharmGKB ID:PA38478
HPRD ID:06160
Substrates:urate, lactate, nicotinate, sodium nitrate
Trivial Names:RST, OAT4L, URAT1
Transcripts:NM_144585.3 [Chr.11(+): 64358282-64369825 GRCh37]
NM_153378.2 [Chr.11(+): 64358282-64369825 GRCh37]
XM_005273744.1 [Chr.11(+): 64358113-64369823 GRCh37]
XM_005273745.1 [Chr.11(+): 64358113-64369823 GRCh37]
XM_005273746.1 [Chr.11(+): 64358113-64369823 GRCh37]
XM_005273740.1 [Chr.11(+): 64358113-64369821 GRCh37]
XM_005273742.1 [Chr.11(+): 64358113-64369821 GRCh37]
XM_005273741.1 [Chr.11(+): 64358113-64369821 GRCh37]
XM_005273743.1 [Chr.11(+): 64358113-64369821 GRCh37]
NM_001276326.1 [Chr.11(+): 64358282-64369825 GRCh37]
NM_001276327.1 [Chr.11(+): 64358282-64369825 GRCh37]
XM_005273747.1 [Chr.11(+): 64361030-64369821 GRCh37]
ENST00000336464 [Chr.11(+): 64358735-64369023 GRCh37]
ENST00000377567 [Chr.11(+): 64358113-64369820 GRCh37]
ENST00000377572 [Chr.11(+): 64358282-64369820 GRCh37]
ENST00000377574 [Chr.11(+): 64358282-64369820 GRCh37]
ENST00000473690 [Chr.11(+): 64358700-64369820 GRCh37]
Annotation History:View Events (90)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC22A12.

Variant Data

View all PMT variants for SLC22A12 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC22A12 RESEQUENCING  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC22A12 RESEQUENCING
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
PromoterPDE
64358089 GRCh37
64114665 NCBI36
-193-940
GTGAACCAAGACGCTGGGTTCCAGG C → A CAGACACTGTGACATGAGAGGCCAT
+ 
 
n=
C/C=
C/A=
A/A=
A=
124
62
0
0
0.000
128
64
0
0
0.000
120
60
0
0
0.000
118
58
1
0
0.008
PMT-272
PromoterPDE
64358100 GRCh37
64114676 NCBI36
-182-929
CGCTGGGTTCCAGGCCAGACACTGT G → A ACATGAGAGGCCATAGCTGAGGTGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
124
61
1
0
0.008
128
61
3
0
0.023
120
60
0
0
0.000
118
54
5
0
0.042
PMT-272
PromoterPDE1 pub
64358241 GRCh37
64114817 NCBI36
-41-788
TTGATGCTGGGAAGCTCCACCGAGG A → T CTCAGGACAGGGTAACAGCAAAGTG
+ 
 
n=
A/A=
A/T=
T/T=
T=
124
40
18
4
0.210
128
7
32
25
0.641
120
38
19
3
0.208
118
11
29
19
0.568
PMT-272
PromoterPDEI
64358265 GRCh37
64114841 NCBI36
-17-764
GACTCAGGACAGGGTAACAGCAAAG T → C GGGCACAGGACGCCAACCACAGCAG
+ 
 
n=
T/T=
T/C=
C/C=
C=
124
28
27
7
0.331
128
7
33
24
0.633
120
38
19
3
0.208
118
11
29
19
0.568
PMT-272
Promoter
Exon 1: 5UTR
PDEI
64358311 GRCh37
64114887 NCBI36
30-718
AGCAGGTGAGTGGAGGCAGGAGCCA C → T GGGTGGGGCCAGGCCACACAGCCTG
+ 
 
n=
C/C=
C/T=
T/T=
T=
124
40
18
4
0.210
128
7
33
24
0.633
120
38
19
3
0.208
118
11
29
19
0.568
PMT-272
Exon 1: 5UTRPDE
64358483 GRCh37
64115059 NCBI36
202-546
AGGTGGGCACACAGGGGCACCGAAG G → A GAGCAGGCAGCCCTGGCATCCCACA
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
67
1
0
0.007
134
67
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
Exon 1: 5UTRPDE
64358560 GRCh37
64115136 NCBI36
279-469
CCCAAGACCTGGCACAGAGCAGGCC G → A GCCCTGGCCCCCAAGCAGAGGAGGC
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
66
2
0
0.015
134
67
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
Exon 1: 5UTRPDE
64358563 GRCh37
64115139 NCBI36
282-466
AAGACCTGGCACAGAGCAGGCCGGC C → G CTGGCCCCCAAGCAGAGGAGGCTGC
+ 
 
n=
C/C=
C/G=
G/G=
G=
136
67
1
0
0.007
134
67
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
Exon 1: 5UTRPDE1 pub
64358605 GRCh37
64115181 NCBI36
324-424
GGAGGCTGCACCTCCCTCGCGTCTG T → C GCCTGCCTCAACGCGGGTTAAACTT
+ 
 
n=
T/T=
T/C=
C/C=
C=
136
8
28
32
0.676
134
24
36
7
0.373
136
4
22
42
0.779
134
21
33
13
0.440
PMT-272
Exon 1: 5UTRPDE
64358618 GRCh37
64115194 NCBI36
337-411
CCCTCGCGTCTGTGCCTGCCTCAAC G → A CGGGTTAAACTTTGACCAAGGAAAT
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
68
0
0
0.000
134
67
0
0
0.000
136
67
1
0
0.007
134
67
0
0
0.000
PMT-272
Exon 1: 5UTRPDE
64358674 GRCh37
64115250 NCBI36
393-355
CTAAACTCGATTCCATAAGTGTCAC C → G GGTCACACTTTAATTCCAGTCTAAA
+ 
 
n=
C/C=
C/G=
G/G=
G=
136
67
1
0
0.007
134
67
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
Exon 1: 5UTRPDE
64358781 GRCh37
64115357 NCBI36
500-248
TCTGGAGCAGCTGCCTCTCTGGGGA G → A ATGCTGGAGGTCTCGGAATCACCTC
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
68
0
0
0.000
134
65
2
0
0.015
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
Exon 1: 5UTRPDE
64358795 GRCh37
64115371 NCBI36
514-234
CTCTCTGGGGAGATGCTGGAGGTCT C → T GGAATCACCTCACGCGGCCTCAGGG
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
68
0
0
0.000
134
62
4
1
0.045
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
Exon 1: 5UTRPDE
64358809 GRCh37
64115385 NCBI36
528-220
GCTGGAGGTCTCGGAATCACCTCAC G → A CGGCCTCAGGGCCCAGTTGGAGCCA
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
45
19
4
0.199
134
7
36
24
0.627
136
42
22
4
0.221
134
13
33
21
0.560
PMT-272
Exon 1: CodingPDE1 pub
64359274 GRCh37
64115850 NCBI36
993246
CTATTTCCATCCCGCCGGGCCCCAA C → T CAGAGGCCCCACCAGTGCCGCCGCT
+82
Asn = Asn
n=
C/C=
C/T=
T/T=
T=
132
64
2
0
0.015
134
67
0
0
0.000
134
26
37
4
0.336
130
59
6
0
0.046
PMT-272
Exon 1: CodingPDE1 pub
64359286 GRCh37
64115862 NCBI36
1005258
CGCCGGGCCCCAACCAGAGGCCCCA C → T CAGTGCCGCCGCTTCCGCCAGCCAC
+86
His = His
n=
C/C=
C/T=
T/T=
T=
132
43
19
4
0.205
134
7
36
24
0.627
134
41
22
4
0.224
130
13
31
21
0.562
PMT-272
Exon 1: CodingPDE
64359419 GRCh37
64115995 NCBI36
1138391
TGACCGCAGCATCTTCACCTCCACA A → G TCGTGGCCAAGGTAGGGCCTCCCCC
+131
Ile → Val
(D=29)
n=
A/A=
A/G=
G/G=
G=
132
65
1
0
0.008
134
67
0
0
0.000
134
67
0
0
0.000
130
65
0
0
0.000
PMT-272
 PDE
64359534 GRCh37
64116110 NCBI36
  
TCCAGTCCTGGGAGGGACCCACCTC C → T CCAGGCCCCACTCACTCTCGAGCCT
+ 
 
n=
C/C=
C/T=
T/T=
T=
132
65
1
0
0.008
134
67
0
0
0.000
134
67
0
0
0.000
130
65
0
0
0.000
PMT-272
Exon 2: CodingPDE3 pubsI
64360274 GRCh37
64116850 NCBI36
1173426
AGTGGAACCTCGTGTGTGACTCTCA T → C GCTCTGAAGCCCATGGCCCAGTCCA
+142
His = His
n=
T/T=
T/C=
C/C=
C=
132
43
19
4
0.205
134
7
36
24
0.627
136
42
22
4
0.221
136
14
31
23
0.566
PMT-272
 PDE
64360404 GRCh37
64116980 NCBI36
  
TCCCAGTTCCCCTCACAACCCCTGC T → C CTCCTAGGACCCTGGCCGACTGGCC
+ 
 
n=
T/T=
T/C=
C/C=
C=
132
64
2
0
0.015
134
67
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
Exon 4: CodingPDE
64361274 GRCh37
64117850 NCBI36
1576829
CTTCTTCCTCTGCTTTTTGTACTCC T → C GGTGGGTGCTGTGCCCCACTCCCCT
+277
Trp → Arg
(D=101)
n=
T/T=
T/C=
C/C=
C=
132
65
1
0
0.008
132
66
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
 PDE
64361368 GRCh37
64117944 NCBI36
  
GACTCTCCTTTCCCTGGGGGCTGGG G → A AGTGCTAGAGGCCAGGGGTGCATGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
62
4
0
0.030
132
66
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
 PDE
64361384 GRCh37
64117960 NCBI36
  
GGGGCTGGGGAGTGCTAGAGGCCAG G → T GGTGCATGGGCTGGAGGAAAGCCAG
+ 
 
n=
G/G=
G/T=
T/T=
T=
132
43
19
4
0.205
132
7
35
24
0.629
136
42
22
4
0.221
134
13
32
22
0.567
PMT-272
 PDE2 pubsI
64365796 GRCh37
64122372 NCBI36
  
CCACAATCCCTAGGAGGGAGAAAGG C → A AGCAGAAGGGGTCTCCTGCTGGGGA
+ 
 
n=
C/C=
C/A=
A/A=
A=
128
17
34
13
0.469
130
7
34
24
0.631
132
41
21
4
0.220
130
10
33
22
0.592
PMT-272
 PDE
64365819 GRCh37
64122395 NCBI36
  
GGCAGCAGAAGGGGTCTCCTGCTGG G → C GAAGGAGGGTGCCCAAGAGGGCTTG
+ 
 
n=
G/G=
G/C=
C/C=
C=
128
64
0
0
0.000
130
65
0
0
0.000
132
65
1
0
0.008
130
65
0
0
0.000
PMT-272
 PDE
64365856 GRCh37
64122432 NCBI36
  
CCCAAGAGGGCTTGGCTGCCACAAC G → A CCCTTCGGGGTCCTCAGCCGCCCTA
+ 
 
n=
G/G=
G/A=
A/A=
A=
128
62
2
0
0.016
130
65
0
0
0.000
132
66
0
0
0.000
130
65
0
0
0.000
PMT-272
 PDE1 pub
64365943 GRCh37
64122519 NCBI36
  
TCTGAGGCTGGCGCAGGCCAGGCAC T → C GGGGGCCACAGGCAATGACCCCTCC
+ 
 
n=
T/T=
T/C=
C/C=
C=
128
42
18
4
0.203
130
8
34
23
0.615
132
41
21
4
0.220
130
12
32
21
0.569
PMT-272
 PDE
64365984 GRCh37
64122560 NCBI36
  
TGACCCCTCCCACGCCCCCTCCACT T → C AAGGTGGCTGGCAGAGTCGGCACGA
+ 
 
n=
T/T=
T/C=
C/C=
C=
128
64
0
0
0.000
130
64
1
0
0.008
132
66
0
0
0.000
130
65
0
0
0.000
PMT-272
 PDE
64366150 GRCh37
64122726 NCBI36
  
CTCCTCAAACCCGGACCCTCAGACC C → T TCTCCCTGCCCCTGCATAGGGCACC
+ 
 
n=
C/C=
C/T=
T/T=
T=
128
64
0
0
0.000
130
64
1
0
0.008
132
66
0
0
0.000
130
65
0
0
0.000
PMT-272
 PDE
64366216 GRCh37
64122792 NCBI36
  
AGGACCTCAGCTCCCTGGGAAGAAG G → T TCTCAGAGAGGAGGAGGTGCCTGGC
+ 
 
n=
G/G=
G/T=
T/T=
T=
128
61
3
0
0.023
130
65
0
0
0.000
132
66
0
0
0.000
130
65
0
0
0.000
PMT-272
Exon 6: CodingPDE
64366350 GRCh37
64122926 NCBI36
17721025
CCTGCCAGCCTGGGCACCCTGCTCC G → A CATGCCCGGACTGCGCTTCCGGACC
+342
Arg → His
(D=29)
n=
G/G=
G/A=
A/A=
A=
128
64
0
0
0.000
130
65
0
0
0.000
132
65
1
0
0.008
130
65
0
0
0.000
PMT-272
 PDE
64367736 GRCh37
64124312 NCBI36
  
AGATGGAGATGACTCCCAAACATTT A → G CAAAGAGGCCTGAAAGTCAGGGACA
+ 
 
n=
A/A=
A/G=
G/G=
G=
128
14
31
19
0.539
126
39
21
3
0.214
130
18
31
16
0.485
134
39
24
4
0.239
PMT-272
Exon 8: CodingPDE4 pubsI
64367862 GRCh37
64124438 NCBI36
20561309
AGAAATGGGGGCTCTGCGCTCAGCC T → C TGGCCGTGCTGGGGCTGGGCGGGGT
+437
Leu = Leu
n=
T/T=
T/C=
C/C=
C=
128
14
31
19
0.539
126
39
21
3
0.214
130
18
31
16
0.485
134
39
24
4
0.239
PMT-272
 PDE
64368072 GRCh37
64124648 NCBI36
  
ATGCATCTCCCTCTTGTGTGGTCCC C → T GGGGCTGCTCAGGTGCATCCCAAGC
+ 
 
n=
C/C=
C/T=
T/T=
T=
128
59
5
0
0.039
126
63
0
0
0.000
130
65
0
0
0.000
134
67
0
0
0.000
PMT-272
 PDE
64368166 GRCh37
64124742 NCBI36
  
CCGGCGTGCAGGATCAAGGCTGTGG G → A CACACAGACCAGGCGCTTATAGGTG
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
65
0
0
0.000
126
63
0
0
0.000
132
65
1
0
0.008
134
67
0
0
0.000
PMT-272
 PDE
64368180 GRCh37
64124756 NCBI36
  
CAAGGCTGTGGGCACACAGACCAGG C → T GCTTATAGGTGCATCTGCATTGGCA
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
64
1
0
0.008
126
63
0
0
0.000
130
65
0
0
0.000
134
67
0
0
0.000
PMT-272
Exon 9: CodingPDE
64368240 GRCh37
64124816 NCBI36
21751428
CAGTGGGCTTGGGCCAGATGGCAGC C → T CGTGGAGGAGCCATCCTGGGGCCTC
+476
Ala = Ala
n=
C/C=
C/T=
T/T=
T=
130
65
0
0
0.000
126
63
0
0
0.000
132
66
0
0
0.000
134
66
1
0
0.007
PMT-272
Exon 9: CodingPDE
64368303 GRCh37
64124879 NCBI36
22381491
TGGGTGTCCATGGCCCCTGGCTGCC C → A TTGCTGGTGTATGGGACGGTGCCAG
+497
Pro = Pro
n=
C/C=
C/A=
A/A=
A=
130
65
0
0
0.000
126
63
0
0
0.000
132
66
0
0
0.000
134
66
1
0
0.007
PMT-272
 PDE
64368428 GRCh37
64125004 NCBI36
  
CAGAACCAGTGAGTGGACCCAGCCT C → T GGGACCACCCCTCCCTCCCACCAGA
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
25
31
9
0.377
126
40
20
3
0.206
132
18
32
16
0.485
134
41
24
2
0.209
PMT-272
 PDE
64368501 GRCh37
64125077 NCBI36
  
GCTCACCCATCCCCATCACTTGACA G → A AGGCGGAAGCAGAGGCCCAGACAGA
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
64
1
0
0.008
126
63
0
0
0.000
132
66
0
0
0.000
134
67
0
0
0.000
PMT-272
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
64368943 GRCh37
64125519 NCBI36
  

G → A, C
ACTCCGCACCCCAAGACACACCCCC G → A TGTGCTTCCTGAACAGGGCAGTAAA
ACTCCGCACCCCAAGACACACCCCC G → C TGTGCTTCCTGAACAGGGCAGTAAA
+ 

 
 
 
n=
G/G=
G/A=
A/A=
G/C=
C/C=
A/C=
A=
C=
132
64
0
0
2
0
0
0.000
0.015
132
66
0
0
0
0
0
0.000
0.000
136
66
2
0
0
0
0
0.015
0.000
134
67
0
0
0
0
0
0.000
0.000
PMT-272
 PDE
64368945 GRCh37
64125521 NCBI36
  
TCCGCACCCCAAGACACACCCCCGT G → A TGCTTCCTGAACAGGGCAGTAAAGA
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
66
0
0
0.000
132
65
1
0
0.008
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
Exon 10: CodingPDE
64368985 GRCh37
64125561 NCBI36
23711624
GGCAGTAAAGAAGGCAACACATGGC A → AAGAAGGCACACATGGTA CGCTGGGGAACTCTGTCCTAAAATC
+542
Thr → INS
n=
A/A=
A/AAGAAGGCACACATGGTA=
AAGAAGGCACACATGGTA/AAGAAGGCACACATGGTA=
AAGAAGGCACACATGGTA=
132
64
2
0
0.015
132
66
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
Exon 10: 3UTRPDE
64369090 GRCh37
64125666 NCBI36
2476 
TTCTTCTGTTCTCTGGAGAAGGCAG G → A AGGAAAGCAAAGACCTCCATTTCCA
+ 
 
n=
G/G=
G/A=
A/A=
A=
128
64
0
0
0.000
132
66
0
0
0.000
136
66
2
0
0.015
134
67
0
0
0.000
PMT-272
Exon 10: 3UTRPDE
64369093 GRCh37
64125669 NCBI36
2479 
TTCTGTTCTCTGGAGAAGGCAGGAG G → A AAAGCAAAGACCTCCATTTCCAGAG
+ 
 
n=
G/G=
G/A=
A/A=
A=
128
63
1
0
0.008
132
66
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
Exon 10: 3UTRPDE
64369175 GRCh37
64125751 NCBI36
2561 
TCCCCCAGGGCTGCCCCTCCAGGTG A → G GCCCTGCCCCTCTCACAGTCCAAGG
+ 
 
n=
A/A=
A/G=
G/G=
G=
128
64
0
0
0.000
132
66
0
0
0.000
136
68
0
0
0.000
134
66
1
0
0.007
PMT-272
Exon 10: 3UTR
64369186 GRCh37
64125762 NCBI36
2572 
TGCCCCTCCAGGTGAGCCCTGCCCC TC → - TCACAGTCCAAGGGGCCCCCTTCA
+ 
 
n=
TC/TC=
TC/-=
-/-=
-=
74
37
0
0
0.000
88
44
0
0
0.000
78
38
1
0
0.013
88
44
0
0
0.000
PMT-272
Exon 10: 3UTRPDE
64369188 GRCh37
64125764 NCBI36
2574 
CCCCTCCAGGTGAGCCCTGCCCCTC TC → - ACAGTCCAAGGGGCCCCCTTCAAT
+ 
 
n=
TC/TC=
TC/-=
-/-=
-=
128
64
0
0
0.000
132
66
0
0
0.000
136
67
1
0
0.007
134
67
0
0
0.000
PMT-272
Exon 10: 3UTRPDE
64369267 GRCh37
64125843 NCBI36
2653 
GCAGGAGGTGACCCAGTGCACCATC A → ACCCTG CCCTGCCCTGCCCTCGTGGCTTCGG
+ 
 
n=
A/A=
A/ACCCTG=
ACCCTG/ACCCTG=
ACCCTG=
116
37
21
0
0.181
90
44
1
0
0.011
78
39
0
0
0.000
94
44
3
0
0.032
PMT-272
Exon 10: 3UTRPDE
64369291 GRCh37
64125867 NCBI36
2677 
CACCCTGCCCTGCCCTCGTGGCTTC G → A GAGAGCAGAGGGGTCAGGCCCAGGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
116
58
0
0
0.000
90
45
0
0
0.000
78
37
2
0
0.026
94
47
0
0
0.000
PMT-272
Exon 10: 3UTR
64369317 GRCh37
64125893 NCBI36
2703 
GAGAGCAGAGGGGTCAGGCCCAGGG G → - AACGAGCTGGCCTTGCCAACCCTCT
+ 
 
n=
G/G=
G/-=
-/-=
-=
136
57
10
1
0.088
136
45
23
0
0.169
136
34
29
5
0.287
134
45
20
2
0.179
PMT-272
Exon 10: 3UTRPDE
64369424 GRCh37
64126000 NCBI36
2810 
GAGCTAACCACCATCCATGGTCAAG A → G CCTCTCCTAGCTCCACACAAGCAGT
+ 
 
n=
A/A=
A/G=
G/G=
G=
136
68
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
134
67
0
0
0.000
PMT-272
Exon 10: 3UTRPDEI
64369540 GRCh37
64126116 NCBI36
2926 
CCCTCCAGGCCTCAGCCACCTGCCC G → A CCACATCCTCTGCCTGCTGTCCCCT
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
57
10
1
0.088
136
45
23
0
0.169
136
34
29
5
0.287
134
45
20
2
0.179
PMT-272
Exon 10: 3UTRPDE
64369586 GRCh37
64126162 NCBI36
2972 
CCCCTTCCCACCCTCATCCCTGACC G → A ACTCCACTTAACCCCCAAACCCAGC
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.