UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:OCTL1
HGNC Symbol:SLC22A13
HGNC Description:solute carrier family 22 (organic anion/urate transporter), member 13
HGNC ID:8494
Superfamily:SLC
Chromosome:Chr.3(+): 38307298-38320161 GRCh37
Location:3p21.3
OMIM:604047
OMIM Phenotype:None
Accessions:AB010438
Nucleotide RefSeq:NM_004256
Protein RefSeq:NP_004247
Entrez:9390
Ensembl:ENSG00000172940
Isoforms:1
Evidence:None
Tissues:None
Type:protein-coding
Sets:0
PharmGKB ID:PA32814
HPRD ID:06810
Substrates:None
Trivial Names:OAT10, OCTL1, OCTL3, ORCTL3, ORCTL-3
Transcripts:NM_004256.3 [Chr.3(+): 38307298-38319806 GRCh37]
ENST00000311856 [Chr.3(+): 38307303-38319806 GRCh37]
ENST00000415844 [Chr.3(+): 38307397-38317819 GRCh37]
ENST00000450935 [Chr.3(+): 38307397-38317819 GRCh37]
Annotation History:View Events (3)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC22A13.

Variant Data

View all PMT variants for SLC22A13 on UCSC Genome Browser
Showing SNP features for transcript: NM_004256  
SLC22A13 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC22A13 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
38306930 GRCh37
38281934 NCBI36
-368-422
CATGTGCCATGGTGGTTTGCTGCAC C → T TATCAACCCATCATCTAGGTTTTAA
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
65
0
0
0.000
132
66
0
0
0.000
132
64
2
0
0.015
132
66
0
0
0.000
PMT-272
 PDE
38306997 GRCh37
38282001 NCBI36
-301-355
ATATTTGTCCTAATGCTCTCCCTCC C → T CTTGTCCCCCACCCCCTGACAGGCC
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
62
2
1
0.031
132
66
0
0
0.000
132
66
0
0
0.000
132
66
0
0
0.000
PMT-272
PromoterPDE
38307176 GRCh37
38282180 NCBI36
-122-176
TCATCCATGTGGACTATTTTTTCAT C → T ATATTCTACCCTTCCCAAGTCACAC
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
64
1
0
0.008
132
66
0
0
0.000
132
66
0
0
0.000
132
66
0
0
0.000
PMT-272
Exon 1: CodingPDE
38307398 GRCh37
38282402 NCBI36
10147
CTGGCTGAAATAGGTGACTTTGGTC G → A CTTCCAGATACAGCTATTGATCCTG
+16
Arg → His
(D=29)
n=
G/G=
G/A=
A/A=
A=
130
65
0
0
0.000
132
63
3
0
0.023
132
66
0
0
0.000
132
66
0
0
0.000
PMT-272
Exon 10: CodingPDE
38318863 GRCh37
38293867 NCBI36
16171563
AATGACAGCCTTCTGCTCCCTCTAG G → T TCCCCCAAATCAGTGCCCTCAGAGA
+521
Arg = Arg
n=
G/G=
G/T=
T/T=
T=
136
68
0
0
0.000
134
67
0
0
0.000
134
67
0
0
0.000
136
67
1
0
0.007
PMT-272
Exon 10: 3UTRPDE
38319197 GRCh37
38294201 NCBI36
1951 
CATCTCCAGAGCCCTGCCCCCAATA C → T TCTGTCTGGGTTAGGATCTTGGGTA
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
62
5
1
0.051
134
60
7
0
0.052
134
66
1
0
0.007
136
62
6
0
0.044
PMT-272
Exon 10: 3UTRPDE
38319246 GRCh37
38294250 NCBI36
2000 
TATGTCTTGGAATTAACTTGTCCTC T → TT AACAATCTTCATGGGGTATGGCTCT
+ 
 
n=
T/T=
T/TT=
TT/TT=
TT=
136
51
16
1
0.132
134
66
1
0
0.007
134
64
3
0
0.022
136
66
2
0
0.015
PMT-272
Exon 10: 3UTRPDE
38319247 GRCh37
38294251 NCBI36
2001 
ATGTCTTGGAATTAACTTGTCCTCT A → G ACAATCTTCATGGGGTATGGCTCTC
+ 
 
n=
A/A=
A/G=
G/G=
G=
136
68
0
0
0.000
134
67
0
0
0.000
134
65
2
0
0.015
136
68
0
0
0.000
PMT-272
Exon 10: 3UTRPDE
38319672 GRCh37
38294676 NCBI36
2426 
GAGGTTTGTTCTGCTCCCCGCCTCA C → A CCCGCCTCCTCCTGCTCATGCTCAG
+ 
 
n=
C/C=
C/A=
A/A=
A=
136
68
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 10: 3UTRPDE
38319682 GRCh37
38294686 NCBI36
2436 
CTGCTCCCCGCCTCACCCCGCCTCC T → C CCTGCTCATGCTCAGCTGCTTCTGG
+ 
 
n=
T/T=
T/C=
C/C=
C=
136
68
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
 PDE
38319847 GRCh37
38294851 NCBI36
  
AGGCTTCTGAAAGCTGCCTTTTCCA C → T GGGCCATCTTCTTGGGCTTCTCAGA
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
68
0
0
0.000
136
68
0
0
0.000
136
66
2
0
0.015
136
68
0
0
0.000
PMT-272
 PDE
38319909 GRCh37
38294913 NCBI36
  
GCCTTGGTATTGTTCCTTAGAATGA G → A CAATATGCTCCCAATGCACTCCCAG
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
64
4
0
0.029
134
66
1
0
0.007
136
68
0
0
0.000
136
67
1
0
0.007
PMT-272
 PDE
38319932 GRCh37
38294936 NCBI36
  
GAGCAATATGCTCCCAATGCACTCC C → T AGCTCCTCTTGGGACCCTTCTCCAG
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
63
4
1
0.044
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.