UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:OCTL2
HGNC Symbol:SLC22A14
HGNC Description:solute carrier family 22, member 14
HGNC ID:8495
Superfamily:SLC
Chromosome:Chr.3(+): 38323785-38360064 GRCh37
Location:3p21.3
OMIM:604048
OMIM Phenotype:None
Accessions:AB011082
Nucleotide RefSeq:NM_004803
Protein RefSeq:NP_004794
Entrez:9389
Ensembl:ENSG00000144671
Isoforms:4
Evidence:None
Tissues:None
Type:protein-coding
Sets:0
PharmGKB ID:PA32815
HPRD ID:06811
Substrates:None
Trivial Names:OCTL2, OCTL4, ORCTL4
Transcripts:NM_004803.3 [Chr.3(+): 38347445-38359859 GRCh37]
XM_005265584.1 [Chr.3(+): 38323785-38360064 GRCh37]
XM_005265586.1 [Chr.3(+): 38323785-38360038 GRCh37]
XM_005265585.1 [Chr.3(+): 38323818-38360064 GRCh37]
ENST00000273173 [Chr.3(+): 38347427-38360066 GRCh37]
ENST00000448498 [Chr.3(+): 38323789-38359740 GRCh37]
ENST00000466887 [Chr.3(+): 38323785-38349190 GRCh37]
ENST00000496724 [Chr.3(+): 38346665-38349652 GRCh37]
Annotation History:View Events (28)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC22A14.

Variant Data

View all PMT variants for SLC22A14 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC22A14 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC22A14 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
38346961 GRCh37
38321965 NCBI36
-484-557
GCTGCTGTTGCAAGGTAATATGCTG A → G CAGTCAGTACTGCTCACCTTCCTCC
+ 
 
n=
A/A=
A/G=
G/G=
G=
134
66
1
0
0.007
124
62
0
0
0.000
130
65
0
0
0.000
116
58
0
0
0.000
PMT-272
 PDE
38347067 GRCh37
38322071 NCBI36
-378-451
CCAGCCTTGGTGCCCCATCTCTGTG G → A CCCAGGCTTCCAGCCTCCCACCTTG
+ 
 
n=
G/G=
G/A=
A/A=
A=
134
56
11
0
0.082
124
54
8
0
0.065
130
46
13
6
0.192
116
52
5
1
0.060
PMT-272
 PDE
38347106 GRCh37
38322110 NCBI36
-339-412
CCTCCCACCTTGGGCCCACCTCCTG G → A CTACAGCCGACGATGCAGATCTTTG
+ 
 
n=
G/G=
G/A=
A/A=
A=
134
66
1
0
0.007
124
62
0
0
0.000
130
65
0
0
0.000
116
58
0
0
0.000
PMT-272
 PDE
38347114 GRCh37
38322118 NCBI36
-331-404
CTTGGGCCCACCTCCTGGCTACAGC C → T GACGATGCAGATCTTTGTTTGTTTT
+ 
 
n=
C/C=
C/T=
T/T=
T=
134
66
1
0
0.007
124
62
0
0
0.000
130
65
0
0
0.000
116
58
0
0
0.000
PMT-272
Exon 1: CodingPDE
38347633 GRCh37
38322637 NCBI36
189116
TCCTGGTCTCTGGAGATGCTGTTAC G → A CAGATTGAGGGCTGTCCACACCAAG
+39
Arg → His
(D=29)
n=
G/G=
G/A=
A/A=
A=
136
57
11
0
0.081
132
58
8
0
0.061
136
49
13
6
0.184
136
59
9
0
0.066
PMT-272
Exon 1: CodingPDE
38347680 GRCh37
38322684 NCBI36
236163
CAAGCAGGATGACAAGTTTGCCAAC C → T TCCTGGATGCGGTGGGGGAGTTTGG
+55
Leu → Phe
(D=22)
n=
C/C=
C/T=
T/T=
T=
136
66
2
0
0.015
132
64
2
0
0.015
136
68
0
0
0.000
136
66
2
0
0.015
PMT-272
Exon 1: CodingPDE
38347694 GRCh37
38322698 NCBI36
250177
AGTTTGCCAACCTCCTGGATGCGGT G → C GGGGAGTTTGGCACATTCCAGCAGA
+59
Val = Val
n=
G/G=
G/C=
C/C=
C=
136
67
1
0
0.007
132
66
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
 PDE
38359610 GRCh37
38334614 NCBI36
  
CTCTTGGGAACGCAGGGTTGGGCGC T → A GCTGAAGGCACAAGCCGCTGCTTTT
+ 
 
n=
T/T=
T/A=
A/A=
A=
134
66
1
0
0.007
132
66
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
 PDE
38359662 GRCh37
38334666 NCBI36
  
TCAGCTTCCAGAAAGATGTGGCCCT G → A GACTCATCCTCTGATGGCTCTTTCA
+ 
 
n=
G/G=
G/A=
A/A=
A=
134
66
1
0
0.007
132
66
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 10: 3UTRPDE
38359829 GRCh37
38334833 NCBI36
1947 
CAACCCTGCCTTGAAGCAATTCAAT A → G AAGAGGAAGCAAACAGCCAGGCTCC
+ 
 
n=
A/A=
A/G=
G/G=
G=
134
65
2
0
0.015
132
66
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
 PDE
38359875 GRCh37
38334879 NCBI36
  
GCTCCCTGAGGGCCAGGCCCCCAGA C → T CATCTTGGGTTGGAATTGAGTGGCC
+ 
 
n=
C/C=
C/T=
T/T=
T=
134
65
2
0
0.015
132
66
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
 PDE
38359930 GRCh37
38334934 NCBI36
  
ATGGGGTCATGGATTCCAGGCCACA A → C ATTCCAGGCCTAGTTCAGTCTGGGG
+ 
 
n=
A/A=
A/C=
C/C=
C=
134
67
0
0
0.000
132
65
1
0
0.008
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
 PDE
38359970 GRCh37
38334974 NCBI36
  
TCAGTCTGGGGGCAGGGTCAGTCCT T → G CTCCCAGGCCAGCCCTTGACATTAA
+ 
 
n=
T/T=
T/G=
G/G=
G=
134
1
23
43
0.813
132
0
1
65
0.992
136
0
0
68
1.000
136
0
2
66
0.985
PMT-272
 
38359993 GRCh37
38334997 NCBI36
  
CTTCTCCCAGGCCAGCCCTTGACAT T → - AAAAAAAATGCCCCCTCCTTCTGCA
+ 
 
n=
T/T=
T/-=
-/-=
-=
134
14
34
19
0.537
132
39
24
3
0.227
136
27
29
12
0.390
136
41
22
5
0.235
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.