UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:FLIPT2
HGNC Symbol:SLC22A16
HGNC Description:solute carrier family 22 (organic cation/carnitine transporter), member 16
HGNC ID:20302
Superfamily:SLC
Chromosome:Chr.6(-): 110745890-110797844 GRCh37
Location:6q22.1
OMIM:608276
OMIM Phenotype:None
Accessions:BC047565
Nucleotide RefSeq:NM_033125
Protein RefSeq:NP_149116
Entrez:85413
Ensembl:ENSG00000004809
Isoforms:4
Evidence:None
Tissues:None
Type:protein-coding
Sets:0
PharmGKB ID:PA134911502
HPRD ID:12202
Substrates:None
Trivial Names:CT2, OAT6, OCT6, OKB1, FLIPT2, dJ261K5.1
Transcripts:NM_033125.3 [Chr.6(-): 110745890-110797844 GRCh37]
XM_005267183.1 [Chr.6(-): 110745890-110797838 GRCh37]
XM_005267184.1 [Chr.6(-): 110745890-110797636 GRCh37]
XM_005267185.1 [Chr.6(-): 110745907-110778024 GRCh37]
ENST00000330550 [Chr.6(-): 110745934-110796181 GRCh37]
ENST00000368919 [Chr.6(-): 110745890-110797844 GRCh37]
ENST00000424139 [Chr.6(-): 110768076-110797599 GRCh37]
ENST00000434949 [Chr.6(-): 110759923-110797643 GRCh37]
ENST00000437378 [Chr.6(-): 110763447-110797601 GRCh37]
ENST00000439654 [Chr.6(-): 110746559-110797844 GRCh37]
ENST00000451557 [Chr.6(-): 110745890-110778024 GRCh37]
ENST00000456137 [Chr.6(-): 110763604-110797816 GRCh37]
ENST00000460159 [Chr.6(-): 110745890-110746585 GRCh37]
ENST00000461487 [Chr.6(-): 110776632-110797844 GRCh37]
Annotation History:View Events (30)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC22A16.

Variant Data

View all PMT variants for SLC22A16 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC22A16 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC22A16 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
110798217 GRCh37
110904910 NCBI36
-373-440
CCGGGGGCCGCAAGAATATATAGCC T → A TCAGCATGACGCCCCTCAGAAACAT
+ 
 
n=
T/T=
T/A=
A/A=
A=
128
61
3
0
0.023
132
51
13
2
0.129
132
39
22
5
0.242
132
54
12
0
0.091
PMT-272
 PDE
110798118 GRCh37
110904811 NCBI36
-274-341
ATGTCTGCGGGGTCGCCACGCTCGA G → A GGAAGCCCCGACGCCTGGGAAAAGT
+ 
 
n=
G/G=
G/A=
A/A=
A=
128
49
15
0
0.117
132
65
1
0
0.008
132
66
0
0
0.000
132
65
1
0
0.008
PMT-272
PromoterPDE
110798045 GRCh37
110904738 NCBI36
-201-268
GTCGCATGGTGCCCTCGCCCCCAGC C → G CCGCCGCTCTCCCACCCGCCCCGCC
+ 
 
n=
C/C=
C/G=
G/G=
G=
128
18
33
13
0.461
132
50
15
1
0.129
132
32
30
4
0.288
132
49
17
0
0.129
PMT-272
PromoterPDE
110798019 GRCh37
110904712 NCBI36
-175-242
GGCGCGCTGTGGTCCCGGCGCCCGC A → G GTCGCATGGTGCCCTCGCCCCCAGC
+ 
 
n=
A/A=
A/G=
G/G=
G=
130
20
35
10
0.423
132
50
15
1
0.129
132
32
30
4
0.288
132
49
17
0
0.129
PMT-272
PromoterPDE
110797998 GRCh37
110904691 NCBI36
-154-221
TGCCGCCTCGGCCTCCTTCCCGGCG C → CGC GCTGTGGTCCCGGCGCCCGCAGTCG
+ 
 
n=
C/C=
C/CGC=
CGC/CGC=
CGC=
130
28
33
4
0.315
132
51
14
1
0.121
132
33
29
4
0.280
132
50
16
0
0.121
PMT-272
PromoterPDE
110797952 GRCh37
110904645 NCBI36
-108-175
CGTCGCTTGGCCCCTCGGTCCCCCC A → T AGTATCTTCGGCTTTTTTCCTGCCG
+ 
 
n=
A/A=
A/T=
T/T=
T=
130
52
13
0
0.100
132
52
14
0
0.106
132
39
24
3
0.227
132
57
9
0
0.068
PMT-272
PromoterPDE
110797946 GRCh37
110904639 NCBI36
-102-169
TCCCTCCGTCGCTTGGCCCCTCGGT C → - CCCCCAAGTATCTTCGGCTTTTTTC
+ 
 
n=
C/C=
C/-=
-/-=
-=
130
20
35
10
0.423
132
50
15
1
0.129
132
33
29
4
0.280
132
49
17
0
0.129
PMT-272
PromoterPDE
110797905 GRCh37
110904598 NCBI36
-61-128
GTCCCAGTGCTCGGGACCAGCGCGA C → G GCTGTATTCTGTTCCTCCCTCCGTC
+ 
 
n=
C/C=
C/G=
G/G=
G=
130
19
35
11
0.438
132
50
15
1
0.129
132
32
30
4
0.288
132
49
17
0
0.129
PMT-272
PromoterPDE
110797896 GRCh37
110904589 NCBI36
-52-119
TCCCCGCGCGTCCCAGTGCTCGGGA C → T CAGCGCGACGCTGTATTCTGTTCCT
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
61
4
0
0.031
132
66
0
0
0.000
132
66
0
0
0.000
132
66
0
0
0.000
PMT-272
Exon 1: 5UTR
Promoter
PDE
110797826 GRCh37
110904519 NCBI36
19-49

G → A, T
GAGTTAGCCGAGCTCCGGGGGCTGC G → A GGTAGCGCGCCCCGCCCCGAACCTC
GAGTTAGCCGAGCTCCGGGGGCTGC G → T GGTAGCGCGCCCCGCCCCGAACCTC
+ 

 
 
 
n=
G/G=
G/A=
A/A=
G/T=
T/T=
A/T=
A=
T=
130
51
0
0
13
1
0
0.000
0.115
132
64
1
0
1
0
0
0.008
0.008
132
66
0
0
0
0
0
0.000
0.000
132
64
1
0
1
0
0
0.008
0.008
PMT-272
Exon 1: 5UTR
Promoter
PDE
110797821 GRCh37
110904514 NCBI36
24-44
GCGCCGAGTTAGCCGAGCTCCGGGG G → A CTGCGGGTAGCGCGCCCCGCCCCGA
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
59
6
0
0.046
132
64
2
0
0.015
132
60
6
0
0.045
132
60
6
0
0.045
PMT-272
 PDE
110778376 GRCh37
110885069 NCBI36
  
ACATATTTATATCTGTGGGTTAGTA T → C ATATACATATATTACTTAGCTCCAT
+ 
 
n=
T/T=
T/C=
C/C=
C=
130
65
0
0
0.000
132
66
0
0
0.000
136
67
1
0
0.007
130
65
0
0
0.000
PMT-272
 PDE
110778326 GRCh37
110885019 NCBI36
  
ATGTTTATCTTAACATATACACGAA T → C GGATAAATATAGAAATAATTATAGA
+ 
 
n=
T/T=
T/C=
C/C=
C=
130
64
1
0
0.008
132
66
0
0
0.000
136
62
6
0
0.044
130
65
0
0
0.000
PMT-272
 PDE
110778248 GRCh37
110884941 NCBI36
  
GCAAGAGAAGAAAAGCTAATTATTA T → C ATCTGGTCTATAGGCTGAAAAAGAA
+ 
 
n=
T/T=
T/C=
C/C=
C=
130
65
0
0
0.000
132
66
0
0
0.000
136
67
1
0
0.007
130
65
0
0
0.000
PMT-272
Exon 2: CodingPDE1 pubI
110778128 GRCh37
110884821 NCBI36
213146
ATTGCCTGGGGGCCTGCAGACATGA T → C GAGGGGTGACTCCCATGAACACAGA
+49
His → Arg
(D=29)
n=
T/T=
T/C=
C/C=
C=
130
23
30
12
0.415
132
31
30
5
0.303
136
32
28
8
0.324
130
45
18
2
0.169
PMT-272
Exon 2: CodingPDE
110778060 GRCh37
110884753 NCBI36
281214
GAAGACAACAGGGCCCCGGTGTCCT C → G CAAACTCCAATTAGAGTGATTATGG
+72
Glu → Gln
(D=29)
n=
C/C=
C/G=
G/G=
G=
130
65
0
0
0.000
132
66
0
0
0.000
136
65
3
0
0.022
130
65
0
0
0.000
PMT-272
Exon 2: CodingPDE1 pubI
110777962 GRCh37
110884655 NCBI36
379312
CCAAACTCGATGTGTTCTCCCTCTT A → G TTCCTGCTACACCTTGAGAGCTCCC
+104
Asn = Asn
n=
A/A=
A/G=
G/G=
G=
130
23
30
12
0.415
132
31
30
5
0.303
136
32
28
8
0.324
130
45
18
2
0.169
PMT-272
Exon 2: CodingPDE
110777767 GRCh37
110884460 NCBI36
574507
TGTCAGAAAAGTAGCCAAAAGTCAC C → T GATCCCAGTAGGACTCCAAACATAA
+169
Ser = Ser
n=
C/C=
C/T=
T/T=
T=
130
65
0
0
0.000
132
66
0
0
0.000
136
67
1
0
0.007
130
65
0
0
0.000
PMT-272
 PDE
110777618 GRCh37
110884311 NCBI36
  
CCCTAAATAATGGATCAGCAAAGAG G → C TAGGTATTTAGATAGGAAGTATAAA
+ 
 
n=
G/G=
G/C=
C/C=
C=
130
65
0
0
0.000
132
66
0
0
0.000
136
67
1
0
0.007
130
65
0
0
0.000
PMT-272
 PDE
110777605 GRCh37
110884298 NCBI36
  
TATCATTATACATCCCTAAATAATG G → A ATCAGCAAAGAGGTAGGTATTTAGA
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
63
2
0
0.015
132
66
0
0
0.000
136
68
0
0
0.000
130
65
0
0
0.000
PMT-272
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
110777561 GRCh37
110884254 NCBI36
  
AACCAGGATTTGGATCTAGGTATAC T → A GTCTTCAGAGCCTATCCTTATCATT
+ 
 
n=
T/T=
T/A=
A/A=
A=
130
46
17
2
0.162
132
60
6
0
0.045
136
68
0
0
0.000
130
60
5
0
0.038
PMT-272
 PDE
110768231 GRCh37
110874924 NCBI36
  
AGTCACACAGTGGAAGAGGAAAGGT A → AA GAGTTGTAACAGTTTAAACATCCAC
+ 
 
n=
A/A=
A/AA=
AA/AA=
AA=
130
65
0
0
0.000
128
64
0
0
0.000
136
67
1
0
0.007
134
67
0
0
0.000
PMT-272
Exon 3: CodingPDE
110768130 GRCh37
110874823 NCBI36
664597
AGGTGTAATAATCAACTGCAAACGC C → T GCTGCTATTCCAAACAAAAACATGC
+199
Ala = Ala
n=
C/C=
C/T=
T/T=
T=
130
65
0
0
0.000
128
64
0
0
0.000
136
68
0
0
0.000
134
66
1
0
0.007
PMT-272
Exon 3: CodingPDE
110768128 GRCh37
110874821 NCBI36
666599
GAAGGTGTAATAATCAACTGCAAAC G → A CCGCTGCTATTCCAAACAAAAACAT
+200
Ala → Val
(D=64)
n=
G/G=
G/A=
A/A=
A=
130
65
0
0
0.000
128
64
0
0
0.000
136
68
0
0
0.000
134
64
3
0
0.022
PMT-272
 PDE
110767960 GRCh37
110874653 NCBI36
  
TGTAGGCAGACTTCTGCAGTGGAGT G → A GACAAAGATGAGTCCTTGATCTCGC
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
64
1
0
0.008
128
64
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
Exon 4: CodingPDE
110763935 GRCh37
110870628 NCBI36
762695
TGTCCGAGACTTCATGCCAATGAAT T → C CCATCACATAGACAAACCCCACCAC
+232
Glu → Gly
(D=98)
n=
T/T=
T/C=
C/C=
C=
132
65
1
0
0.008
134
64
3
0
0.022
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272
Exon 4: CodingPDE
110763910 GRCh37
110870603 NCBI36
787720
AGGAATGCAAATGGACAGACGCCCA T → C GTCCGAGACTTCATGCCAATGAATT
+240
Thr = Thr
n=
T/T=
T/C=
C/C=
C=
132
66
0
0
0.000
134
67
0
0
0.000
136
67
1
0
0.007
132
66
0
0
0.000
PMT-272
Exon 4: CodingPDE1 pubI
110763875 GRCh37
110870568 NCBI36
822755
TGTCAAAGCCACCAGCAGGGTTCCA A → G CTGCAAAAAAGGAATGCAAATGGAC
+252
Val → Ala
(D=64)
n=
A/A=
A/G=
G/G=
G=
132
52
13
1
0.114
134
56
11
0
0.082
136
59
9
0
0.066
132
52
13
1
0.114
PMT-272
Exon 4: CodingPDE
110763811 GRCh37
110870504 NCBI36
886819
TAAAGGGGACAGTCACTGTGGAGAG G → A ATCATCTGGTAAAGCCACCAGGTCC
+273
Ile = Ile
n=
G/G=
G/A=
A/A=
A=
132
66
0
0
0.000
134
66
1
0
0.007
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272
Exon 4: CodingPDE
110763742 GRCh37
110870435 NCBI36
955888
GTGCTTCTTCATATCGTCCCTCTGA G → C AGAAGCCAAAAAGGTGTCTCTGGGA
+296
Leu = Leu
n=
G/G=
G/C=
C/C=
C=
132
65
1
0
0.008
134
67
0
0
0.000
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272
Exon 4: CodingPDE
110763547 GRCh37
110870240 NCBI36
11501083
TTCCAGTGAACCAGATTAGCCAAAC G → A GTAAGTGTCCTTTTCGTAATGCTCC
+361
Thr = Thr
n=
G/G=
G/A=
A/A=
A=
132
62
3
1
0.038
134
67
0
0
0.000
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272
Exon 4: CodingPDE
110763506 GRCh37
110870199 NCBI36
11911124
TAAGTTAACAGAATTCAAGGAAAAC G → A AGTAGAATCCCAAACTTCCAGTGAA
+375
Ser → Leu
(D=145)
n=
G/G=
G/A=
A/A=
A=
132
66
0
0
0.000
134
67
0
0
0.000
136
68
0
0
0.000
132
65
1
0
0.008
PMT-272
 PDE
110763410 GRCh37
110870103 NCBI36
  
ACACACACAAATGGTAGAAATCTCA C → A TTCACTGCCAAATTTAAATATACTG
+ 
 
n=
C/C=
C/A=
A/A=
A=
132
63
3
0
0.023
134
67
0
0
0.000
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272
 PDE
110760199 GRCh37
110866892 NCBI36
  
ACTCTCTAAGAATTGCTGCGAGGCA G → A CCAGCCCCGCCACTTTTAAACTCAC
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
63
3
0
0.023
130
65
0
0
0.000
134
67
0
0
0.000
134
66
1
0
0.007
PMT-272
Exon 5: CodingPDE1 pubI
110760008 GRCh37
110866701 NCBI36
12931226
GACTGTTCTCCTCCCGACCTTGTCC A → G TGGCGATGCACACGAAGGTGTAGGC
+409
Met → Thr
(D=81)
n=
A/A=
A/G=
G/G=
G=
132
57
9
0
0.068
130
41
21
3
0.208
134
67
0
0
0.000
134
44
20
3
0.194
PMT-272
Exon 5: CodingPDE
110759957 GRCh37
110866650 NCBI36
13441277
CACCATAACGACACCACAGGCCAGT G → T CACTGCAGAAAAGAGAGTAGGCCAG
+426
Ala → Glu
(D=107)
n=
G/G=
G/T=
T/T=
T=
132
66
0
0
0.000
130
65
0
0
0.000
134
67
0
0
0.000
134
66
1
0
0.007
PMT-272
Exon 5: CodingPDE
110759943 GRCh37
110866636 NCBI36
13581291
CTCACCTGGGGGATCACCATAACGA C → T ACCACAGGCCAGTGCACTGCAGAAA
+431
Val → Ile
(D=29)
n=
C/C=
C/T=
T/T=
T=
132
62
4
0
0.030
130
65
0
0
0.000
134
67
0
0
0.000
134
66
1
0
0.007
PMT-272
Exon 5: CodingPDE
110759940 GRCh37
110866633 NCBI36
13611294
TAACTCACCTGGGGGATCACCATAA C → T GACACCACAGGCCAGTGCACTGCAG
+432
Val → Ile
(D=29)
n=
C/C=
C/T=
T/T=
T=
132
63
3
0
0.023
130
65
0
0
0.000
134
67
0
0
0.000
134
66
1
0
0.007
PMT-272
 PDE
110759904 GRCh37
110866597 NCBI36
  
CTGTCACAGTATAACTGTCTTATAA A → G AAACAGAAGATAACTCACCTGGGGG
+ 
 
n=
A/A=
A/G=
G/G=
G=
132
64
2
0
0.015
130
65
0
0
0.000
134
67
0
0
0.000
134
67
0
0
0.000
PMT-272
 PDE
110759826 GRCh37
110866519 NCBI36
  
TATTATATACTCTGCCCAAATCATA C → T TCTGAATTGACCTTCATACTTAACT
+ 
 
n=
C/C=
C/T=
T/T=
T=
132
48
17
1
0.144
130
60
5
0
0.038
134
67
0
0
0.000
134
63
4
0
0.030
PMT-272
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
110759815 GRCh37
110866508 NCBI36
  
AGATTTTTAAATATTATATACTCTG C → T CCAAATCATACTCTGAATTGACCTT
+ 
 
n=
C/C=
C/T=
T/T=
T=
132
63
3
0
0.023
130
65
0
0
0.000
134
67
0
0
0.000
134
66
1
0
0.007
PMT-272
 PDE
110759758 GRCh37
110866451 NCBI36
  
TTTCTAAAATGAACATATATTACTT ATATAAC → - AGAAAAAGAATGTTTTAAA
+ 
 
n=
ATATAAC/ATATAAC=
ATATAAC/-=
-/-=
-=
132
65
1
0
0.008
130
52
11
2
0.115
134
63
4
0
0.030
134
67
0
0
0.000
PMT-272
 PDE
110759743 GRCh37
110866436 NCBI36
  
TTTTTCTCTTCAAATTTTCTAAAAT G → A AACATATATTACTTATATAACAGAA
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
65
1
0
0.008
130
65
0
0
0.000
134
67
0
0
0.000
134
67
0
0
0.000
PMT-272
 PDE
110757216 GRCh37
110863909 NCBI36
  
ATCACAAGTGGTATTTTTAAAGGAA A → G ATAGAAAATCTTTAAAATCATTACT
+ 
 
n=
A/A=
A/G=
G/G=
G=
132
64
1
1
0.023
134
52
12
3
0.134
136
64
4
0
0.029
136
68
0
0
0.000
PMT-272
 PDE
110757201 GRCh37
110863894 NCBI36
  
TTAGCAGAATAGATCATCACAAGTG G → C TATTTTTAAAGGAAAATAGAAAATC
+ 
 
n=
G/G=
G/C=
C/C=
C=
132
65
1
0
0.008
134
66
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
 PDE
110757183 GRCh37
110863876 NCBI36
  
AATGTTTCTGAAAAAAATTTAGCAG A → C ATAGATCATCACAAGTGGTATTTTT
+ 
 
n=
A/A=
A/C=
C/C=
C=
132
65
1
0
0.008
134
67
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
PMT-272
Exon 6: CodingPDE
110757156 GRCh37
110863849 NCBI36
13871320
CCATAGCTGTCACCACACCCAAAAT A → G TAATGTTTCTGAAAAAAATTTAGCA
+440
Tyr = Tyr
n=
A/A=
A/G=
G/G=
G=
132
64
2
0
0.015
134
67
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 6: CodingPDE
110757132 GRCh37
110863825 NCBI36
14111344
CTGCCCCGATGGCAAATTTTCCAAC C → T ATAGCTGTCACCACACCCAAAATAT
+448
Met → Ile
(D=10)
n=
C/C=
C/T=
T/T=
T=
132
66
0
0
0.000
134
67
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
PMT-272
Exon 6: CodingPDE
110757114 GRCh37
110863807 NCBI36
14291362
GATAAATGAGGCCAAATGCTGCCCC G → T ATGGCAAATTTTCCAACCATAGCTG
+454
Ile = Ile
n=
G/G=
G/T=
T/T=
T=
132
66
0
0
0.000
134
66
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
 PDEIA
110757008 GRCh37
110863701 NCBI36
  
AGGCCAAATACAATGAAATGACACA C → A AAGTGAAAGATAATAGGAAAACAAC
+ 
 
n=
C/C=
C/A=
A/A=
A=
132
46
18
2
0.167
134
49
12
6
0.179
136
64
4
0
0.029
136
64
4
0
0.029
PMT-272
 PDE
110756974 GRCh37
110863667 NCBI36
  
GTAACTTCTATAAAAAAGAAGCATT T → C ACATGTAAAGGCCAAATACAATGAA
+ 
 
n=
T/T=
T/C=
C/C=
C=
132
66
0
0
0.000
134
67
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
PMT-272
 PDEI
110756960 GRCh37
110863653 NCBI36
  
TCTCAGAGATCCAGGTAACTTCTAT A → G AAAAAGAAGCATTTACATGTAAAGG
+ 
 
n=
A/A=
A/G=
G/G=
G=
132
9
33
24
0.614
134
27
32
8
0.358
136
33
27
8
0.316
136
45
19
4
0.199
PMT-272
 PDE
110752694 GRCh37
110859387 NCBI36
  
TTCAATATGTTTAGATACACAAATA T → C TTACCATTGTGTTACGACTGCCTGC
+ 
 
n=
T/T=
T/C=
C/C=
C=
132
56
8
2
0.091
130
54
11
0
0.085
136
63
5
0
0.037
130
58
6
1
0.062
PMT-272
 PDE
110752654 GRCh37
110859347 NCBI36
  
GAGATTATAATAGCACATTTTTACT C → T GACTTTTTCTATCTTTCAATATGTT
+ 
 
n=
C/C=
C/T=
T/T=
T=
132
64
2
0
0.015
130
65
0
0
0.000
136
68
0
0
0.000
130
65
0
0
0.000
PMT-272
 PDE
110752632 GRCh37
110859325 NCBI36
  
CAGTCAACCTCGGTGGCCCCGCGAG A → G TTATAATAGCACATTTTTACTCGAC
+ 
 
n=
A/A=
A/G=
G/G=
G=
132
57
8
1
0.076
130
54
11
0
0.085
136
63
5
0
0.037
130
58
6
1
0.062
PMT-272
 PDE
110752627 GRCh37
110859320 NCBI36
  
CGTTTCAGTCAACCTCGGTGGCCCC G → A CGAGATTATAATAGCACATTTTTAC
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
64
2
0
0.015
130
65
0
0
0.000
136
68
0
0
0.000
130
65
0
0
0.000
PMT-272
 PDE
110752626 GRCh37
110859319 NCBI36
  
ACGTTTCAGTCAACCTCGGTGGCCC C → A GCGAGATTATAATAGCACATTTTTA
+ 
 
n=
C/C=
C/A=
A/A=
A=
132
51
14
1
0.121
130
36
28
1
0.231
136
31
27
10
0.346
130
30
28
7
0.323
PMT-272
 PDE
110752560 GRCh37
110859253 NCBI36
  
CTGCTTCCTGCAGCTCCTTTCCCAC G → A CTCCCCAGCAAGGATAAGGGTGGTC
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
64
2
0
0.015
130
65
0
0
0.000
136
67
1
0
0.007
130
58
7
0
0.054
PMT-272
 PDE
110752546 GRCh37
110859239 NCBI36
  
AGGGATTGAGGGACCTGCTTCCTGC A → C GCTCCTTTCCCACGCTCCCCAGCAA
+ 
 
n=
A/A=
A/C=
C/C=
C=
132
51
13
2
0.129
130
65
0
0
0.000
136
68
0
0
0.000
130
64
1
0
0.008
PMT-272
Exon 7: CodingPDE
110752455 GRCh37
110859148 NCBI36
15071440
TGGCCAGGCGACACACCATGCTGCC G → C CTTCCCACAGCCAGCGATCTGGAAA
+480
Ser → Arg
(D=110)
n=
G/G=
G/C=
C/C=
C=
132
66
0
0
0.000
130
64
1
0
0.008
136
68
0
0
0.000
130
65
0
0
0.000
PMT-272
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
Exon 7: CodingPDE
110752419 GRCh37
110859112 NCBI36
15431476
TGCTGCTGAGGTCCACAGAGAACGG C → T GCCAGGATGCTGGCCAGGCGACACA
+492
Ala = Ala
n=
C/C=
C/T=
T/T=
T=
132
66
0
0
0.000
130
65
0
0
0.000
136
67
1
0
0.007
130
65
0
0
0.000
PMT-272
 PDE
110752337 GRCh37
110859030 NCBI36
  
TAATAGGCAATTAGAAACTGCCTCC G → A TGCCCCCTTGGGGAGGGTCTGCAAA
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
65
1
0
0.008
130
62
3
0
0.023
136
68
0
0
0.000
130
59
5
1
0.054
PMT-272
 PDE
110752336 GRCh37
110859029 NCBI36
  
CTAATAGGCAATTAGAAACTGCCTC C → T GTGCCCCCTTGGGGAGGGTCTGCAA
+ 
 
n=
C/C=
C/T=
T/T=
T=
132
65
1
0
0.008
130
65
0
0
0.000
136
68
0
0
0.000
130
65
0
0
0.000
PMT-272
 PDEIA
110752289 GRCh37
110858982 NCBI36
  
TTAGGAAATGATGTACTGGCTTTCA G → A TAAATAACAATAGAGAAGTTGCTAA
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
4
18
43
0.800
130
26
32
7
0.354
136
10
34
24
0.603
130
21
33
11
0.423
PMT-272
 PDE
110752280 GRCh37
110858973 NCBI36
  
CAAACCCCATTAGGAAATGATGTAC T → G GGCTTTCAGTAAATAACAATAGAGA
+ 
 
n=
T/T=
T/G=
G/G=
G=
132
65
1
0
0.008
130
65
0
0
0.000
136
68
0
0
0.000
130
65
0
0
0.000
PMT-272
 PDE
110752275 GRCh37
110858968 NCBI36
  
TTCTACAAACCCCATTAGGAAATGA T → G GTACTGGCTTTCAGTAAATAACAAT
+ 
 
n=
T/T=
T/G=
G/G=
G=
132
65
1
0
0.008
130
65
0
0
0.000
136
68
0
0
0.000
130
65
0
0
0.000
PMT-272
Exon 8: CodingPDE
110746146 GRCh37
110852839 NCBI36
17311664
TTCCAGCCCACTATTATTAGTTGTG A → G GAAGTAATTTGCTTGACTTGCTTTC
+555
Leu → Pro
(D=98)
n=
A/A=
A/G=
G/G=
G=
132
60
6
0
0.045
132
66
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 8: CodingPDE
110746108 GRCh37
110852801 NCBI36
17691702
CCAAGACCAGAATCCCTGGGGGTAA T → A CGCTTCCGTTTTTTCCAGCCCACTA
+568
Ile → Phe
(D=21)
n=
T/T=
T/A=
A/A=
A=
132
66
0
0
0.000
132
65
1
0
0.008
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 8: 3UTRPDE
110745977 GRCh37
110852670 NCBI36
1900 
TTTTCTTACAAAATTTATTAAAAAG A → T CATACAAACAACATATGGGAGATGA
+ 
 
n=
A/A=
A/T=
T/T=
T=
132
48
16
2
0.152
132
39
24
3
0.227
136
28
26
14
0.397
136
30
32
6
0.324
PMT-272
Exon 8: 3UTRPDE
110745971 GRCh37
110852664 NCBI36
1906 
TTAAAATTTTCTTACAAAATTTATT A → T AAAAGACATACAAACAACATATGGG
+ 
 
n=
A/A=
A/T=
T/T=
T=
132
66
0
0
0.000
132
66
0
0
0.000
136
68
0
0
0.000
136
66
2
0
0.015
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.