UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:BOCT
HGNC Symbol:SLC22A17
HGNC Description:solute carrier family 22, member 17
HGNC ID:23095
Superfamily:SLC
Chromosome:Chr.14(-): 23815520-23822380 GRCh37
Location:14q11.2
OMIM:611461
OMIM Phenotype:None
Accessions:AJ243653
Nucleotide RefSeq:NM_020372
Protein RefSeq:NP_065105
Entrez:51310
Ensembl:ENSG00000092096
Isoforms:4
Evidence:None
Tissues:None
Type:protein-coding
Sets:0
PharmGKB ID:PA134879149
HPRD ID:15349
Substrates:None
Trivial Names:BOCT, BOIT, 24p3R, NGALR, hBOIT, NGALR2, NGALR3
Transcripts:NM_016609.3 [Chr.14(-): 23815539-23822080 GRCh37]
NM_020372.2 [Chr.14(-): 23815527-23821479 GRCh37]
XM_005267748.1 [Chr.14(-): 23815525-23822380 GRCh37]
XM_005267747.1 [Chr.14(-): 23815525-23822377 GRCh37]
ENST00000206544 [Chr.14(-): 23815527-23821760 GRCh37]
ENST00000354772 [Chr.14(-): 23815515-23822121 GRCh37]
ENST00000397260 [Chr.14(-): 23815523-23822069 GRCh37]
ENST00000397267 [Chr.14(-): 23815539-23822080 GRCh37]
ENST00000473917 [Chr.14(-): 23815533-23818971 GRCh37]
ENST00000474057 [Chr.14(-): 23815525-23822117 GRCh37]
ENST00000474774 [Chr.14(-): 23816368-23817430 GRCh37]
ENST00000556803 [Chr.14(-): 23820128-23821252 GRCh37]
ENST00000557699 [Chr.14(-): 23817836-23821785 GRCh37]
Annotation History:View Events (21)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC22A17.

Variant Data

View all PMT variants for SLC22A17 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC22A17 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC22A17 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
23821930 GRCh37
22891770 NCBI36
-451-507
CCCCGCCATTGGGCTCGGGGGTCCC G → A GTGGCCACCCGGGGAGCCAGCTTGC
+ 
 
n=
G/G=
G/A=
A/A=
A=
120
59
1
0
0.008
134
67
0
0
0.000
134
67
0
0
0.000
130
65
0
0
0.000
PMT-272
 PDE
23821921 GRCh37
22891761 NCBI36
-442-498
TGCCGCCGCCCCCGCCATTGGGCTC G → A GGGGTCCCGGTGGCCACCCGGGGAG
+ 
 
n=
G/G=
G/A=
A/A=
A=
120
60
0
0
0.000
134
67
0
0
0.000
134
66
1
0
0.007
130
65
0
0
0.000
PMT-272
 PDE
23821777 GRCh37
22891617 NCBI36
-298-354
GCAGTCAGGGGCGAGGGATGCGCAG G → A AGGAAAATGCCAGACGCTCCGCGGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
120
60
0
0
0.000
134
67
0
0
0.000
134
67
0
0
0.000
130
64
1
0
0.008
PMT-272
PromoterPDE
23821719 GRCh37
22891559 NCBI36
-240-296
GAAGCGGAGGAAACCGCAGAGCAAG G → T GCAGGGGGCAGGTGGGAGGGAGGGC
+ 
 
n=
G/G=
G/T=
T/T=
T=
120
59
1
0
0.008
134
67
0
0
0.000
134
67
0
0
0.000
130
65
0
0
0.000
PMT-272
PromoterPDE
23821710 GRCh37
22891550 NCBI36
-231-287
GAGAAGGGTGAAGCGGAGGAAACCG C → T AGAGCAAGGGCAGGGGGCAGGTGGG
+ 
 
n=
C/C=
C/T=
T/T=
T=
120
59
1
0
0.008
134
67
0
0
0.000
134
67
0
0
0.000
130
65
0
0
0.000
PMT-272
PromoterPDE
23821649 GRCh37
22891489 NCBI36
-170-226
GCTCCGTGGGCACCGCATCTCCGAG G → A GTCCCGACCTGCTGTTGGGGGGCAG
+ 
 
n=
G/G=
G/A=
A/A=
A=
120
60
0
0
0.000
134
66
1
0
0.007
134
67
0
0
0.000
130
65
0
0
0.000
PMT-272
Exon 1: CodingPDE
23821361 GRCh37
22891201 NCBI36
11963
GCTGCTCCCAGCCAGAGGCATTAGG G → A GGGAAGGCCCCGTAGTGGCAATGCA
+21
Pro = Pro
n=
G/G=
G/A=
A/A=
A=
120
55
5
0
0.042
134
65
2
0
0.015
134
60
5
2
0.067
130
62
3
0
0.023
PMT-272
 PDE
23816277 GRCh37
22886117 NCBI36
  
TGGGGGAGCGGGAGGCGAGGGGGCC C → T GGCTCTGCCCCTGGGGGCACCCCTG
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
 PDE
23816261 GRCh37
22886101 NCBI36
  
GTCCTCAGGGGTGGGGTGGGGGAGC G → A GGAGGCGAGGGGGCCCGGCTCTGCC
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
68
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
134
67
0
0
0.000
PMT-272
Exon 9: CodingPDE
23816040 GRCh37
22885880 NCBI36
14901434
TGCAGAGGAGGGCGCAGGCCGCCAG C → T ACCACGTGCTGCAGGAAGGCTCCAT
+478
Val = Val
n=
C/C=
C/T=
T/T=
T=
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
Exon 9: CodingPDE
23816039 GRCh37
22885879 NCBI36
14911435
ATGCAGAGGAGGGCGCAGGCCGCCA G → T CACCACGTGCTGCAGGAAGGCTCCA
+479
Leu → Met
(D=15)
n=
G/G=
G/T=
T/T=
T=
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
Exon 9: CodingPDE
23816034 GRCh37
22885874 NCBI36
14961440
TGAGAATGCAGAGGAGGGCGCAGGC C → T GCCAGCACCACGTGCTGCAGGAAGG
+480
Ala = Ala
n=
C/C=
C/T=
T/T=
T=
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
134
66
1
0
0.007
PMT-272
Exon 9: CodingPDE
23815981 GRCh37
22885821 NCBI36
15491493
CCGGAGCACCTCGGGCAGGAGCTTG C → T GCTTGGTCTCCGGCAGCAGCATAAT
+498
Arg → His
(D=29)
n=
C/C=
C/T=
T/T=
T=
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
Exon 9: CodingPDE
23815909 GRCh37
22885749 NCBI36
16211565
CAGCGGGACGTGGTCACAGCGGGTA G → A GGGGTGGCTGCCGCAGCAGGGAAGG
+522
Pro → Leu
(D=98)
n=
G/G=
G/A=
A/A=
A=
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
134
66
1
0
0.007
PMT-272
Exon 9: 3UTRPDE
23815836 GRCh37
22885676 NCBI36
1694 
ACCTTTCTGTGTGGGCCAGCCTCCC G → A CCAGGGTACTCAGAGGCCGCTCAGA
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
64
4
0
0.029
136
68
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
Exon 9: 3UTRPDE
23815835 GRCh37
22885675 NCBI36
1695 
CACCTTTCTGTGTGGGCCAGCCTCC C → T GCCAGGGTACTCAGAGGCCGCTCAG
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
68
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
134
67
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.