UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:HET
HGNC Symbol:SLC22A18
HGNC Description:solute carrier family 22, member 18
HGNC ID:10964
Superfamily:SLC
Chromosome:Chr.11(+): 2920951-2946476 GRCh37
Location:11p15.5
OMIM:602631
OMIM Phenotype:Breast cancer; Rhambdomyosarcoma; Lung cancer, somatic
Accessions:AF037064,AF059663,BC015571,BG489795
Nucleotide RefSeq:NM_002555
Protein RefSeq:NP_002546
Entrez:5002
Ensembl:ENSG00000110628
Isoforms:4
Evidence:None
Tissues:Kidney, Liver, Wilm's Tumors
Type:protein-coding
Sets:0
PharmGKB ID:PA35846
HPRD ID:04024
Substrates:Chloroquine, Quinidine
Trivial Names:HET, ITM, BWR1A, IMPT1, TSSC5, ORCTL2, BWSCR1A, SLC22A1L, p45-BWR1A
Transcripts:NM_002555.5 [Chr.11(+): 2923512-2946476 GRCh37]
NM_183233.2 [Chr.11(+): 2920951-2946476 GRCh37]
XM_005252952.1 [Chr.11(+): 2923655-2946476 GRCh37]
XM_005252953.1 [Chr.11(+): 2935912-2946476 GRCh37]
ENST00000312221 [Chr.11(+): 2923423-2946476 GRCh37]
ENST00000347936 [Chr.11(+): 2920951-2946476 GRCh37]
ENST00000380574 [Chr.11(+): 2923650-2946476 GRCh37]
ENST00000441077 [Chr.11(+): 2937912-2946476 GRCh37]
ENST00000449603 [Chr.11(+): 2938178-2946413 GRCh37]
ENST00000449793 [Chr.11(+): 2923513-2946457 GRCh37]
ENST00000463571 [Chr.11(+): 2937466-2946332 GRCh37]
ENST00000467719 [Chr.11(+): 2937376-2942468 GRCh37]
ENST00000485423 [Chr.11(+): 2924344-2930586 GRCh37]
ENST00000492567 [Chr.11(+): 2924606-2937616 GRCh37]
ENST00000495518 [Chr.11(+): 2943198-2946470 GRCh37]
ENST00000498209 [Chr.11(+): 2937873-2943056 GRCh37]
ENST00000498244 [Chr.11(+): 2930503-2931048 GRCh37]

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC22A18.

Variant Data

View all PMT variants for SLC22A18 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC22A18 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC22A18 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
2920820 GRCh37
2877396 NCBI36
-2692-3756
GGCTCGCTGGCCCACAACCAAAGCC G → A CTTCCTCTGGAGGAGGAAGTCCAGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
68
0
0
0.000
130
65
0
0
0.000
132
65
1
0
0.008
132
66
0
0
0.000
PMT-272
 PDE
2920835 GRCh37
2877411 NCBI36
-2677-3741
AACCAAAGCCGCTTCCTCTGGAGGA G → C GAAGTCCAGGGGTGCCAGGGTTCCA
+ 
 
n=
G/G=
G/C=
C/C=
C=
136
68
0
0
0.000
130
65
0
0
0.000
132
65
1
0
0.008
132
66
0
0
0.000
PMT-272
 PDE
2920945 GRCh37
2877521 NCBI36
-2567-3631
AAGTTCCCCCATTCACACTGAGCCT G → C TTCATGACAAAAAAAAAGGTCTCTC
+ 
 
n=
G/G=
G/C=
C/C=
C=
136
68
0
0
0.000
130
64
1
0
0.008
132
66
0
0
0.000
132
66
0
0
0.000
PMT-272
 
2920955 GRCh37
2877531 NCBI36
-2557-3621
ATTCACACTGAGCCTGTTCATGACA A → - AAAAAAAGGTCTCTCCGATTTCCTC
+ 
 
n=
A/A=
A/-=
-/-=
-=
136
60
6
2
0.074
136
61
6
1
0.059
136
19
38
11
0.441
136
54
14
0
0.103
PMT-272
 PDE
2921061 GRCh37
2877637 NCBI36
-2451-3515
GGTAAGTTTCCAGCATCTCCACCAC A → T CCTCAGCGCCAGAGGACCCTCAGCC
+ 
 
n=
A/A=
A/T=
T/T=
T=
136
67
1
0
0.007
126
63
0
0
0.000
132
66
0
0
0.000
132
66
0
0
0.000
PMT-272
 PDEI
2923091 GRCh37
2879667 NCBI36
-421-1485
ACCCTCTACAACCTCCCCTGACTTC T → G TCCCCTAACCCCTCACCACCATTCC
+ 
 
n=
T/T=
T/G=
G/G=
G=
128
18
30
16
0.484
132
17
26
23
0.545
134
50
14
3
0.149
132
24
32
10
0.394
PMT-272
 PDE
2923138 GRCh37
2879714 NCBI36
-374-1438
TTCCTCCGCTTTTCTCTCCCCGCCC C → T TGCCTCCCCTCCATTCTCTCCTTCC
+ 
 
n=
C/C=
C/T=
T/T=
T=
132
66
0
0
0.000
134
67
0
0
0.000
134
67
0
0
0.000
132
65
1
0
0.008
PMT-272
PromoterPDE
2923408 GRCh37
2879984 NCBI36
-104-1168
GTGAGAGCGCAGAAACCGTGGCACG G → C GCGCTCCCGGAACTGGCGATTGCAA
+ 
 
n=
G/G=
G/C=
C/C=
C=
132
63
2
1
0.030
134
67
0
0
0.000
134
67
0
0
0.000
132
66
0
0
0.000
PMT-272
Exon 11: CodingPDE
2946313 GRCh37
2902889 NCBI36
13761161
TGGGACCCACGGTCGGCGGCCTCCT G → A TACCGCAGCTTTGGCGTCCCCGTCT
+387
Leu = Leu
n=
G/G=
G/A=
A/A=
A=
136
64
4
0
0.029
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 11: CodingPDE
2946317 GRCh37
2902893 NCBI36
13801165
ACCCACGGTCGGCGGCCTCCTGTAC C → T GCAGCTTTGGCGTCCCCGTCTTCGG
+389
Arg → Cys
(D=180)
n=
C/C=
C/T=
T/T=
T=
136
68
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 11: CodingPDE
2946346 GRCh37
2902922 NCBI36
14091194
GCTTTGGCGTCCCCGTCTTCGGCCA C → T GTGCAGGTTGCTATCAATACCCTTG
+398
His = His
n=
C/C=
C/T=
T/T=
T=
136
64
4
0
0.029
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 11: CodingPDE
2946347 GRCh37
2902923 NCBI36
14101195
CTTTGGCGTCCCCGTCTTCGGCCAC G → T TGCAGGTTGCTATCAATACCCTTGT
+399
Val → Leu
(D=32)
n=
G/G=
G/T=
T/T=
T=
136
64
4
0
0.029
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 11: CodingPDE
2946406 GRCh37
2902982 NCBI36
14691254
TCCTCTGGAGGAAACCTATGCCCCA G → A AGGAAGGACAAAGTCCGGTGACCGC
+418
Gln = Gln
n=
G/G=
G/A=
A/A=
A=
136
65
3
0
0.022
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
 PDE
2946522 GRCh37
2903098 NCBI36
  
GCAGGCTCACGCATGGTCTGCCTGC G → A TCCTTCAGTGAGGGATGGGGCCTCG
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
55
13
0
0.096
136
42
19
7
0.243
136
43
23
2
0.199
136
53
14
1
0.118
PMT-272
 PDE
2946541 GRCh37
2903117 NCBI36
  
GCCTGCGTCCTTCAGTGAGGGATGG G → A GCCTCGGGCTGGAGGGCTTCCTCAA
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
46
20
2
0.176
136
67
1
0
0.007
136
68
0
0
0.000
136
66
2
0
0.015
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.