UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:OCT2
HGNC Symbol:SLC22A2
HGNC Description:solute carrier family 22 (organic cation transporter), member 2
HGNC ID:10966
Superfamily:SLC
Chromosome:Chr.6(-): 160637794-160679963 GRCh37
Location:6q25.3
OMIM:602608
OMIM Phenotype:None
Accessions:X98333
Nucleotide RefSeq:NM_003058
Protein RefSeq:NP_003049
Entrez:6582
Ensembl:ENSG00000112499
Isoforms:1
Evidence:None
Tissues:kidney (strong), placenta, CNS neurons
Type:protein-coding
Sets:I,IV
PharmGKB ID:PA331
HPRD ID:04008
Substrates:TEA, MPP+, NMN, amantadine, memantine, agmatine, dopamine, histamine, norepinephrine, serotonin, choline, prostaglandin E2, prostaglandin F2alpha
Trivial Names:OCT2
Transcripts:NM_003058.3 [Chr.6(-): 160637794-160679963 GRCh37]
ENST00000366952 [Chr.6(-): 160665217-160698670 GRCh37]
ENST00000366953 [Chr.6(-): 160637794-160680048 GRCh37]
ENST00000486916 [Chr.6(-): 160592093-160666573 GRCh37]
ENST00000489644 [Chr.6(-): 160678782-160679771 GRCh37]
ENST00000491092 [Chr.6(-): 160638485-160679790 GRCh37]
ENST00000498556 [Chr.6(-): 160638046-160639316 GRCh37]
Annotation History:View Events (8)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC22A2.

Variant Data

View all PMT variants for SLC22A2 on UCSC Genome Browser
Showing SNP features for transcript: NM_003058  
SLC22A2 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC22A2 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 PDE
160680557 GRCh37
160600547 NCBI36
-594-768
ACACAAAGATAGTGGCTTGGACACA C → T CTGCCTGCATTTACACTTGACCTGT
- 
 
n=
C/C=
C/T=
T/T=
T=
126
63
0
0
0.000
134
67
0
0
0.000
128
63
1
0
0.008
132
66
0
0
0.000
n/a
0.000
PMT-272
 PDE
160680225 GRCh37
160600215 NCBI36
-262-436
GTGTGTTTTCTCCATAGGGCCTTGA A → T GAAAAGCTGGCGGTGCGCATGAGAT
- 
 
n=
A/A=
A/T=
T/T=
T=
126
63
0
0
0.000
134
67
0
0
0.000
128
63
1
0
0.008
132
66
0
0
0.000
n/a
0.000
PMT-272
 PDE
160680224 GRCh37
160600214 NCBI36
-261-435
TGTGTTTTCTCCATAGGGCCTTGAA G → T AAAAGCTGGCGGTGCGCATGAGATA
- 
 
n=
G/G=
G/T=
T/T=
T=
126
62
1
0
0.008
134
67
0
0
0.000
128
64
0
0
0.000
132
66
0
0
0.000
n/a
0.000
PMT-272
PromoterPDE
160680213 GRCh37
160600203 NCBI36
-250-424
CATAGGGCCTTGAAGAAAAGCTGGC G → A GTGCGCATGAGATAGGAGTATATTA
- 
 
n=
G/G=
G/A=
A/A=
A=
126
59
3
1
0.040
134
66
1
0
0.007
128
64
0
0
0.000
132
65
1
0
0.008
n/a
0.000
PMT-272
PromoterPDE
160680035 GRCh37
160600025 NCBI36
-72-246
TGTGGAGAACCAGTTATAATAAACA C → T GACAGGCATCCTGGGAGTGAGCTCA
- 
 
n=
C/C=
C/T=
T/T=
T=
126
57
5
1
0.056
134
66
1
0
0.007
128
64
0
0
0.000
132
66
0
0
0.000
n/a
0.000
PMT-272
PromoterPDE
160679999 GRCh37
160599989 NCBI36
-36-210
CTGGGAGTGAGCTCAGGGCATTTGG G → A AAGTGCAGAAGGACATGCACCCCCG
- 
 
n=
G/G=
G/A=
A/A=
A=
126
63
0
0
0.000
134
67
0
0
0.000
128
64
0
0
0.000
132
65
1
0
0.008
n/a
0.000
PMT-272
PromoterPDE
160679984 GRCh37
160599974 NCBI36
-21-195
GGGCATTTGGGAAGTGCAGAAGGAC A → G TGCACCCCCGCTGGAGGGGTGCACC
- 
 
n=
A/A=
A/G=
G/G=
G=
126
61
2
0
0.016
134
67
0
0
0.000
128
64
0
0
0.000
132
66
0
0
0.000
n/a
0.000
PMT-272
Exon 1: 5UTRPDE
160679848 GRCh37
160599838 NCBI36
116-59
GGGTTTGTGCTGAGCTGGCTGCAGC C → G GCTCTCAGCCTCGCTCCGGGCACGT
- 
 
n=
C/C=
C/G=
G/G=
G=
126
62
1
0
0.008
134
67
0
0
0.000
128
64
0
0
0.000
132
66
0
0
0.000
n/a
0.000
PMT-272
Exon 1: 5UTRPDEI
160679836 GRCh37
160599826 NCBI36
128-47
AGCTGGCTGCAGCCGCTCTCAGCCT C → T GCTCCGGGCACGTCGGGCAGCCTCG
- 
 
n=
C/C=
C/T=
T/T=
T=
200
100
0
0
0.000
198
99
0
0
0.000
60
29
1
0
0.017
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 1: 5UTRPDE
160679835 GRCh37
160599825 NCBI36
129-46
GCTGGCTGCAGCCGCTCTCAGCCTC G → T CTCCGGGCACGTCGGGCAGCCTCGG
- 
 
n=
G/G=
G/T=
T/T=
T=
126
63
0
0
0.000
134
67
0
0
0.000
128
63
1
0
0.008
132
66
0
0
0.000
n/a
0.000
PMT-272
Exon 1: 5UTRPDE
160679812 GRCh37
160599802 NCBI36
152-23
TCGCTCCGGGCACGTCGGGCAGCCT C → G GGGCCCTCCTGCCTGCAGGATCATG
- 
 
n=
C/C=
C/G=
G/G=
G=
126
63
0
0
0.000
134
67
0
0
0.000
128
63
1
0
0.008
132
66
0
0
0.000
n/a
0.000
PMT-272
Exon 1: Coding
160679657 GRCh37
160599647 NCBI36
307133
CTACGTGGGCATCGTCTTCCTGGGC T → TA TCACCCCTGACCACCGCTGCCGGAG
-45
Phe → INS
n=
T/T=
T/TA=
TA/TA=
TA=
200
100
0
0
0.000
198
98
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 1: CodingPDE
160679630 GRCh37
160599620 NCBI36
334160
CACCCCTGACCACCGCTGCCGGAGC C → T CCGGAGTGGCCGAGCTGAGTCTGCG
-54
Pro → Ser
(D=74)
n=
C/C=
C/T=
T/T=
T=
200
99
1
0
0.005
198
99
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 1: CodingPDEI
160679400 GRCh37
160599390 NCBI36
564390
GCCGGGACGGCTGGGTGTACGAGAC G → T CCTGGCTCGTCCATCGTCACCGAGG
-130
Thr = Thr
n=
G/G=
G/T=
T/T=
T=
200
65
29
6
0.205
198
40
40
19
0.394
60
19
10
1
0.200
20
5
5
0
0.250
14
5
2
0
0.143
Set-I
Exon 2: CodingPDEI
160677683 GRCh37
160597673 NCBI36
655481
CCAGTCATCAGTGAATGTAGGATTC T → C TTATTGGCTCTATGAGTATCGGCTA
-161
Phe → Leu
(D=22)
n=
T/T=
T/C=
C/C=
C=
198
99
0
0
0.000
196
97
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 2: CodingPDEI
160677671 GRCh37
160597661 NCBI36
667493
GAATGTAGGATTCTTTATTGGCTCT A → G TGAGTATCGGCTACATAGCAGACAG
-165
Met → Val
(D=21)
n=
A/A=
A/G=
G/G=
G=
198
98
1
0
0.005
196
98
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 2: CodingPDEI
160677669 GRCh37
160597659 NCBI36
669495
ATGTAGGATTCTTTATTGGCTCTAT G → A AGTATCGGCTACATAGCAGACAGGT
-165
Met → Ile
(D=10)
n=
G/G=
G/A=
A/A=
A=
198
96
3
0
0.015
196
98
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDEI
160677614 GRCh37
160597604 NCBI36
  
TGAATCACCTGTGGTGGAATTTAAA C → G AATCCCAAAGGTTTGGAGAACACTT
- 
 
n=
C/C=
C/G=
G/G=
G=
198
61
5
33
0.359
196
45
1
52
0.536
60
2
0
28
0.933
20
6
0
4
0.400
14
1
0
6
0.857
Set-I
 PDE
160671752 GRCh37
160591742 NCBI36
  
TCAAAATTAATTCAATTCCCTCTCT T → C TGTTTTTCTTCCTGCAGGTTTGGCC
- 
 
n=
T/T=
T/C=
C/C=
C=
200
94
6
0
0.030
198
99
0
0
0.000
58
29
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
Exon 3: CodingPDEI
160671584 GRCh37
160591574 NCBI36
843669
AAGCAGGCTGGTTAATAGGCTACAT C → T CTGAGTAAGAATGTTTGTGCTTGCA
-223
Ile = Ile
n=
C/C=
C/T=
T/T=
T=
200
100
0
0
0.000
198
99
0
0
0.000
58
28
1
0
0.017
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 4: CodingPDE23 pubsI
160670282 GRCh37
160590272 NCBI36
982808
CTGGAGGTGGTTGCAGTTCACAGTT G → T CTCTGCCCAACTTCTTCTTCTTGCT
Higher renal clearance and net tubular secretion of metformin in individual with the OCT2 variant. PMID: 19940846.
-270
Ala → Ser
(D=99)
n=
G/G=
G/T=
T/T=
T=
200
79
20
1
0.110
196
71
23
4
0.158
58
24
5
0
0.086
20
7
3
0
0.150
14
6
1
0
0.071
Set-I
 PDE
160668349 GRCh37
160588339 NCBI36
  
GGAGGATTCAGTAAGAGTTGCCCTC C → T GCTCACCTTGTACCCTAGGTGCATA
- 
 
n=
C/C=
C/T=
T/T=
T=
200
99
1
0
0.005
198
99
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 5: CodingPDE
160668283 GRCh37
160588273 NCBI36
1064890
TGGCTGATCTCCCAGAATAAGAATG C → G TGAAGCCATGAGAATCATTAAGCAC
-297
Ala → Gly
(D=60)
n=
C/C=
C/G=
G/G=
G=
200
98
2
0
0.010
198
97
2
0
0.010
60
30
0
0
0.000
20
10
0
0
0.000
14
6
1
0
0.071
Set-I
 
160668188 GRCh37
160588178 NCBI36
  
GAGCCAGGGCCTTAAGTATCAAATC A → - GGGGATGGAGAAAAGGGAGGCTCTG
- 
 
n=
A/A=
A/-=
-/-=
-=
198
72
25
2
0.146
198
74
24
1
0.131
60
29
1
0
0.017
20
9
1
0
0.050
14
6
1
0
0.071
Set-I
 
160668187 GRCh37
160588177 NCBI36
  
AGCCAGGGCCTTAAGTATCAAATCA G → - GGGATGGAGAAAAGGGAGGCTCTGG
- 
 
n=
G/G=
G/-=
-/-=
-=
198
73
25
1
0.136
198
75
24
0
0.121
60
29
1
0
0.017
20
9
1
0
0.050
14
6
1
0
0.071
Set-I
Exon 7: CodingPDE1 pubI
160664685 GRCh37
160584675 NCBI36
13721198
CTTCATGATCATCCTCACCATCGAC C → T GCATCGGACGCCGTTACCCTTGGGC
Increased sensitivity to inhibition by TBA in oocytes. PMID: 19940846.
-400
Arg → Cys
(D=180)
n=
C/C=
C/T=
T/T=
T=
200
97
3
0
0.015
194
97
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
12
6
0
0
0.000
Set-I
Exon 7: CodingPDEI
160664680 GRCh37
160584670 NCBI36
13771203
TGATCATCCTCACCATCGACCGCAT C → T GGACGCCGTTACCCTTGGGCTGCAT
-401
Ile = Ile
n=
C/C=
C/T=
T/T=
T=
200
100
0
0
0.000
194
96
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
12
6
0
0
0.000
Set-I
 PDE
160663469 GRCh37
160583459 NCBI36
  
CACTGTCTGAAGATGAGGAATCATC T → C GTGTACGGATAAGTACTGTTCTTTT
- 
 
n=
T/T=
T/C=
C/C=
C=
200
99
1
0
0.005
200
100
0
0
0.000
60
26
4
0
0.067
20
10
0
0
0.000
14
6
1
0
0.071
Set-I
Exon 8: CodingPDEI
160663420 GRCh37
160583410 NCBI36
14681294
TTCCCTCTTAGATCTACAATGGCTA A → C AAATTATTATCTCATGCTTGGGAAG
Increased sensitivity to inhibition by TBA in oocytes. PMID: 19940846.
-432
Lys → Gln
(D=53)
n=
A/A=
A/C=
C/C=
C=
200
98
2
0
0.010
200
100
0
0
0.000
60
30
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
Exon 9: CodingPDEI
160662609 GRCh37
160582599 NCBI36
15721398
GTTTCCTGCATTCTAGGAATCTTGG C → T GTCCACATCTGTTCCTCAATGTGTG
-466
Gly = Gly
n=
C/C=
C/T=
T/T=
T=
194
94
3
0
0.015
198
99
0
0
0.000
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDEI
160662481 GRCh37
160582471 NCBI36
  
GGTAAGAAATCTTCACAGATGTCTT T → C AAGTGAAAACTTATTTTTCTAGAGA
- 
 
n=
T/T=
T/C=
C/C=
C=
194
96
1
0
0.005
196
98
0
0
0.000
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 10: CodingPDEI
160645832 GRCh37
160565822 NCBI36
16801506
ATTCATCTGTTTGGCTTTCAGGCGT A → G CTTGGCTTGGTTGCTGGAGGTCTGG
-502
Val = Val
n=
A/A=
A/G=
G/G=
G=
200
24
52
24
0.500
200
53
36
11
0.290
60
23
7
0
0.117
20
4
6
0
0.300
14
5
2
0
0.143
Set-I
Exon 10: CodingPDEI
160645751 GRCh37
160565741 NCBI36
17611587
CTTTGCCTGAGACCATCGAGGAAGC C → T GAAAATATGCAAAGGTAGGCAGTTG
-529
Ala = Ala
n=
C/C=
C/T=
T/T=
T=
200
100
0
0
0.000
200
100
0
0
0.000
60
29
1
0
0.017
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 11: 3UTRPDE
160638357 GRCh37
160558347 NCBI36
1949 
GCCCATACAACTCAACCAAACTTAC C → A CCTGAGCCCTATCAACCTAGGTCTA
- 
 
n=
C/C=
C/A=
A/A=
A=
200
99
1
0
0.005
198
95
4
0
0.020
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 11: 3UTRPDE
160638325 GRCh37
160558315 NCBI36
1981 
TTTCCACAGTGTACAATAGACTCCA C → T TGGCTGTAGACCTAGGTTGATAGGG
+ 
 
n=
C/C=
C/T=
T/T=
T=
128
63
0
1
0.016
130
65
0
0
0.000
132
66
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272
Exon 11: 3UTRPDEI
160638263 GRCh37
160558253 NCBI36
2043 
CTAGGAATGCTGAGAATAAAGTGAG C → T TGGAAGAATTTGGCAGGATCTGGTC
+ 
 
n=
C/C=
C/T=
T/T=
T=
128
63
1
0
0.008
130
65
0
0
0.000
132
66
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272
Exon 11: 3UTR
160638203 GRCh37
160558193 NCBI36
2103 
CATTGGTTTTCTGGAGGGTTTTTTT T → TT CCATCTTTGTATTTTTTTAAATTTG
- 
 
n=
T/T=
T/TT=
TT/TT=
TT=
198
93
6
0
0.030
192
96
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 11: 3UTRPDE
160638202 GRCh37
160558192 NCBI36
2104 
TCAAATTTAAAAAAATACAAAGATG G → GA AAAAAAAACCCTCCAGAAAACCAAT
+ 
 
n=
G/G=
G/GA=
GA/GA=
GA=
128
62
2
0
0.016
130
65
0
0
0.000
132
66
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272
Exon 11: 3UTRPDE
160638193 GRCh37
160558183 NCBI36
2113 
AGAAAAGAATCAAATTTAAAAAAAT A → G CAAAGATGGAAAAAAAACCCTCCAG
+ 
 
n=
A/A=
A/G=
G/G=
G=
124
62
0
0
0.000
130
63
2
0
0.015
132
66
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272
Exon 11: 3UTRPDEI
160638104 GRCh37
160558094 NCBI36
2202 
CTCCCAACTTTACTGTTTTTCACAC T → A TTTTTCTATTTTGTTTGCCTAGCCC
+ 
 
n=
T/T=
T/A=
A/A=
A=
124
39
21
2
0.202
130
54
10
1
0.092
132
65
1
0
0.008
136
55
13
0
0.096
n/a
0.000
PMT-272
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 11: 3UTRPDEI
160638076 GRCh37
160558066 NCBI36
2230 
TTATTTCTTTAAGAAAATAGATGCT C → T CTCTCCCAACTTTACTGTTTTTCAC
+ 
 
n=
C/C=
C/T=
T/T=
T=
124
39
21
2
0.202
130
54
10
1
0.092
132
65
1
0
0.008
136
55
13
0
0.096
n/a
0.000
PMT-272
Exon 11: 3UTRPDE
160638003 GRCh37
160557993 NCBI36
2303 
ACCTGTGTTACTGAAAGGCCTATCT A → T AAATTCTTGACATACATTCTGGACA
+ 
 
n=
A/A=
A/T=
T/T=
T=
124
39
21
2
0.202
130
54
10
1
0.092
132
65
1
0
0.008
136
55
13
0
0.096
n/a
0.000
PMT-272
Exon 11: 3UTRPDEI
160637975 GRCh37
160557965 NCBI36
2331 

T → A, G
TAATCAATGTATTTTTAAAAATTTC T → A TCACCTGTGTTACTGAAAGGCCTAT
TAATCAATGTATTTTTAAAAATTTC T → G TCACCTGTGTTACTGAAAGGCCTAT
+ 

 
 
 
n=
T/T=
T/A=
A/A=
T/G=
G/G=
A/G=
A=
G=
124
17
1
0
29
13
2
0.024
0.460
130
1
0
0
19
45
0
0.000
0.838
132
0
0
0
19
47
0
0.000
0.856
136
1
0
0
25
41
1
0.007
0.794
n/a
0.000
0.000
PMT-272
Exon 11: 3UTRPDEI
160637890 GRCh37
160557880 NCBI36
2416 
TCTAAATATGGAAGGACCTCATGAT C → T ACTTAAGTTGTATTCCTGATTCTTT
+ 
 
n=
C/C=
C/T=
T/T=
T=
124
6
22
34
0.726
130
0
9
56
0.931
132
0
18
48
0.864
136
0
14
54
0.897
n/a
0.000
PMT-272
Exon 11: 3UTRPDEI
160637844 GRCh37
160557834 NCBI36
2462 
TCTTCTCAAGGTCTTTTGTAGAAAA T → C ACACATTCATGCTTACCCAATCTAA
+ 
 
n=
T/T=
T/C=
C/C=
C=
124
39
21
2
0.202
130
54
10
1
0.092
132
65
1
0
0.008
136
55
13
0
0.096
n/a
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.