UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:OCT3
HGNC Symbol:SLC22A3
HGNC Description:solute carrier family 22 (organic cation transporter), member 3
HGNC ID:10967
Superfamily:SLC
Chromosome:Chr.6(+): 160769405-160873613 GRCh37
Location:6q25.3
OMIM:604842
OMIM Phenotype:None
Accessions:AJ001417
Nucleotide RefSeq:NM_021977
Protein RefSeq:NP_068812
Entrez:6581
Ensembl:ENSG00000146477
Isoforms:3
Evidence:None
Tissues:liver, placenta, kidney, skeletal muscle, heart, brain, lung
Type:protein-coding
Sets:I,IV
PharmGKB ID:PA330
HPRD ID:05328
Substrates:MPP+, cimetidine, agmatine, epinephrine, norepinephrine, serotonin, tyramine
Trivial Names:EMT, EMTH, OCT3
Transcripts:NM_021977.3 [Chr.6(+): 160769405-160873611 GRCh37]
XM_005267107.1 [Chr.6(+): 160769410-160847390 GRCh37]
XM_005267106.1 [Chr.6(+): 160769892-160873613 GRCh37]
ENST00000275300 [Chr.6(+): 160769300-160873613 GRCh37]
ENST00000392145 [Chr.6(+): 160769425-160876014 GRCh37]
Annotation History:View Events (25)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC22A3.

Variant Data

View all PMT variants for SLC22A3 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC22A3 RESEQUENCING  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC22A3 RESEQUENCING
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
PromoterPDE
160769279 GRCh37
160689269 NCBI36
-126-173
GTGGCCCGGGGCTGCTGCGGGCGCC C → G GGGGAAGAGAGGCGGGGGCCGCGGG
+ 
 
n=
C/C=
C/G=
G/G=
G=
108
51
3
0
0.028
132
66
0
0
0.000
110
54
1
0
0.009
126
63
0
0
0.000
n/a
0.000
PMT-272
PromoterPDE
160769301 GRCh37
160689291 NCBI36
-104-151
GCCCGGGGAAGAGAGGCGGGGGCCG C → G GGGGGGCAGGAGGAGCGGCTGCGGC
+ 
 
n=
C/C=
C/G=
G/G=
G=
108
52
2
0
0.019
132
66
0
0
0.000
110
55
0
0
0.000
126
63
0
0
0.000
n/a
0.000
PMT-272
PromoterPDE1 pub
160769344 GRCh37
160689334 NCBI36
-61-108
GCTGCGGCCGGCACAGCGCCAGGGC GA → - GTGAGGCGGGTGGCGCGGGGGAGG
Increased luciferase reporter activity and stronger transcription factor-binding affinity. PMID: 22231567.
+ 
 
n=
GA/GA=
GA/-=
-/-=
-=
130
52
11
2
0.115
134
66
1
0
0.007
110
55
0
0
0.000
130
63
2
0
0.015
n/a
0.000
PMT-272
Promoter
Exon 1: 5UTR
PDE1 pub
160769423 GRCh37
160689413 NCBI36
19-29
GGTCCGCGGGTCACTCCGAGGCGCG G → A GCTGCGGGCGGCGGGCGGCGGGCGC
Increased luciferase reporter activity and stronger transcription factor-binding affinity. Increased transcription rate and higher expression levels in liver. PMID: 22231567.
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
14
30
21
0.554
134
16
35
16
0.500
130
33
22
10
0.323
130
25
30
10
0.385
n/a
0.000
PMT-272
Promoter
Exon 1: 5UTR
PDE
160769426 GRCh37
160689416 NCBI36
22-26
CCGCGGGTCACTCCGAGGCGCGGGC T → TGCGGGCG GCGGGCGGCGGGCGGCGGGCGCACC
Reduced luciferase reporter activity. PMID: 22231567.
+ 
 
n=
T/T=
T/TGCGGGCG=
TGCGGGCG/TGCGGGCG=
TGCGGGCG=
130
65
0
0
0.000
134
67
0
0
0.000
130
55
10
0
0.077
130
65
0
0
0.000
n/a
0.000
PMT-272
Exon 1: CodingPDE1 pubI
160769582 GRCh37
160689572 NCBI36
178131
TTCGTCGGCGTGGTCTTCCTGGGCA C → T GCAGCCCGACCACTACTGGTGCCGC
Increased uptake of MPP+ and histamine in transfected HEK293 cells. Increased metformin uptake 60% over reference in transfected HEK293 cells. PMID: 20859243.
+44
Thr → Met
(D=81)
n=
C/C=
C/T=
T/T=
T=
166
82
1
0
0.006
168
83
1
0
0.006
58
29
0
0
0.000
20
10
0
0
0.000
14
5
2
0
0.143
Set-I
Exon 1: CodingPDE
160769703 GRCh37
160689693 NCBI36
299252
CCGCCTCCCGCGGCCCAGAGCCCCC C → A GAGCGCCGCGGCCGCTGCCAGCGCT
+84
Pro = Pro
n=
C/C=
C/A=
A/A=
A=
180
88
2
0
0.011
174
87
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 1: CodingPDE1 pub
160769797 GRCh37
160689787 NCBI36
393346
TCTCAGCTGCGCGGACCCACTCGCC G → T CCTTCCCCAACCGTTCGGCTCCCCT
+116
Ala → Ser
(D=99)
n=
G/G=
G/T=
T/T=
T=
180
88
1
1
0.017
174
87
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 1: CodingPDE
160769811 GRCh37
160689801 NCBI36
407360
ACCCACTCGCCGCCTTCCCCAACCG T → C TCGGCTCCCCTTGTGCCGTGCCGCG
+120
Arg = Arg
n=
T/T=
T/C=
C/C=
C=
180
34
37
19
0.417
172
26
35
25
0.494
60
6
11
13
0.617
20
4
2
4
0.500
14
3
0
4
0.571
Set-I
 PDE1 pub
160769965 GRCh37
160689955 NCBI36
  
GACAAGCCGCGTGTGAGACGCTGGC C → T GCCAGGGGAGGTCGGTGGAGACGGG
+ 
 
n=
C/C=
C/T=
T/T=
T=
176
64
23
1
0.142
170
85
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDEI
160829983 GRCh37
160749973 NCBI36
  
TGTGGTTTTGGTTATCATCATATTT A → G TACTGATTCTGCAGAAATTAGACTC
+ 
 
n=
A/A=
A/G=
G/G=
G=
200
98
2
0
0.010
194
97
0
0
0.000
60
30
0
0
0.000
14
7
0
0
0.000
14
7
0
0
0.000
Set-I
 PDEI
160831890 GRCh37
160751880 NCBI36
  
CAAATTACTCAGAGGTAATTTCTTT C → T AGTATGAGTAACAAATATTGCTAAA
+ 
 
n=
C/C=
C/T=
T/T=
T=
200
81
18
1
0.100
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDEI
160857932 GRCh37
160777922 NCBI36
  
TTGGTAAGTTTGACTTGTGATGGAT T → C TAAAAGCTTGCGTTAAATTTACAAT
+ 
 
n=
T/T=
T/C=
C/C=
C=
198
99
0
0
0.000
198
99
0
0
0.000
56
28
0
0
0.000
20
10
0
0
0.000
14
6
1
0
0.071
Set-I
 PDEI
160857949 GRCh37
160777939 NCBI36
  
TGATGGATTTAAAAGCTTGCGTTAA A → C TTTACAATACATCCCTTCCTTCAAA
+ 
 
n=
A/A=
A/C=
C/C=
C=
198
93
6
0
0.030
198
97
2
0
0.010
56
28
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 7: CodingPDE2 pubsI
160858154 GRCh37
160778144 NCBI36
12461199
CCAGGAGCTCTCTTGATCTTACTAA C → T CATTGAGCGCCTTGGACGACGCCTC
Reduced uptake of dopamine, norepinephrine, and epinephrine in transfected HEK293 cells. Metformin uptake decreased 80% from reference. PMID: 20859243.
+400
Thr → Ile
(D=89)
n=
C/C=
C/T=
T/T=
T=
198
99
0
0
0.000
198
98
1
0
0.005
56
28
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 7: CodingPDE2 pubsIA
160858188 GRCh37
160778178 NCBI36
12801233
GCCTTGGACGACGCCTCCCCTTTGC G → A GCAAGCAATATAGTGGCAGGGGTGG
+411
Ala = Ala
n=
G/G=
G/A=
A/A=
A=
198
76
21
2
0.126
198
40
46
13
0.364
56
7
17
4
0.446
20
4
5
1
0.350
14
1
5
1
0.500
Set-I
 PDEI
160863918 GRCh37
160783908 NCBI36
  
AACATTACGGTAATTCTAACAAACG T → G TATAGTTTCTCCTAAGTAACTCTGT
+ 
 
n=
T/T=
T/G=
G/G=
G=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 9: CodingPDEI
160864758 GRCh37
160784748 NCBI36
15411494
GGCTAGCAGCCGTGTGGCTAGAACT A → G CCTCTGATCATCTTTGGTAAGAACT
+498
Leu = Leu
n=
A/A=
A/G=
G/G=
G=
200
95
5
0
0.025
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 11: 3UTRPDE
160872191 GRCh37
160792181 NCBI36
1821 
CGTGTGCATTTCAGCTACATCATGC C → T GCGCTGTTGTAATACTGTATAAAGA
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
68
0
0
0.000
136
66
2
0
0.015
136
68
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272
Exon 11: 3UTRPDE
160872244 GRCh37
160792234 NCBI36
1874 
TCAATCTATCCAGAGTATTTTTATA T → C AATGTTGGATGAGTTAGGATTTGTA
+ 
 
n=
T/T=
T/C=
C/C=
C=
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 11: 3UTRPDE
160872326 GRCh37
160792316 NCBI36
1956 
TGTAGCCAGTTTAACAAAGAAGCTG T → G CAGGTGCACAGCCCTTCCTGGGTTT
+ 
 
n=
T/T=
T/G=
G/G=
G=
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272
Exon 11: 3UTRPDE
160872333 GRCh37
160792323 NCBI36
1963 
AGTTTAACAAAGAAGCTGTCAGGTG C → T ACAGCCCTTCCTGGGTTTTTTTCTT
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
64
4
0
0.029
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272
Exon 11: 3UTRPDE
160872407 GRCh37
160792397 NCBI36
2037 
ATTAGGCTAAAGAGAGACAAGAGAA G → C CCCCCAACCTGATTCTCATGACAGC
+ 
 
n=
G/G=
G/C=
C/C=
C=
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272
Exon 11: 3UTR
160872408 GRCh37
160792398 NCBI36
2038 
TTAGGCTAAAGAGAGACAAGAGAAG C → - CCCCAACCTGATTCTCATGACAGCT
+ 
 
n=
C/C=
C/-=
-/-=
-=
136
61
6
1
0.059
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272
Exon 11: 3UTRPDE
160872545 GRCh37
160792535 NCBI36
2175 
CCTAGCTGACCATTCATTCTGAAGA T → C TGCATGGAGGATGAACATCTGGGAA
+ 
 
n=
T/T=
T/C=
C/C=
C=
122
57
4
0
0.033
136
67
1
0
0.007
136
68
0
0
0.000
136
67
1
0
0.007
n/a
0.000
PMT-272
Exon 11: 3UTRPDE
160872602 GRCh37
160792592 NCBI36
2232 
TAATGAGAAGGCTGAATCACAGGCA C → A CTGGGCCAAAGGGTGTGAGCATTCA
+ 
 
n=
C/C=
C/A=
A/A=
A=
122
61
0
0
0.000
136
68
0
0
0.000
136
65
3
0
0.022
136
68
0
0
0.000
n/a
0.000
PMT-272
Exon 11: 3UTRPDEI
160872609 GRCh37
160792599 NCBI36
2239 
AAGGCTGAATCACAGGCACCTGGGC C → T AAAGGGTGTGAGCATTCATGTTCTC
+ 
 
n=
C/C=
C/T=
T/T=
T=
122
60
1
0
0.008
136
63
5
0
0.037
136
68
0
0
0.000
136
67
1
0
0.007
n/a
0.000
PMT-272
Exon 11: 3UTRPDE
160872648 GRCh37
160792638 NCBI36
2278 
ATTCATGTTCTCTGCTCACCTTGGT T → C TCCGCACACCTTCGCAATGTGAACA
+ 
 
n=
T/T=
T/C=
C/C=
C=
122
55
6
0
0.049
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272
Exon 11: 3UTRPDE2 pubs
160872652 GRCh37
160792642 NCBI36
2282 
ATGTTCTCTGCTCACCTTGGTTTCC G → A CACACCTTCGCAATGTGAACAGGTC
+ 
 
n=
G/G=
G/A=
A/A=
A=
122
47
13
1
0.123
136
33
30
5
0.294
136
30
31
7
0.331
136
21
31
16
0.463
n/a
0.000
PMT-272
Exon 11: 3UTRPDE
160872968 GRCh37
160792958 NCBI36
2598 
TTTCTTATATTTGTGAGTTCAGTTC C → T GATGGTGCCCGTGGTCAAAAGCGAA
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
68
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
n/a
0.000
PMT-272
Exon 11: 3UTRPDE
160872979 GRCh37
160792969 NCBI36
2609 
TGTGAGTTCAGTTCCGATGGTGCCC G → A TGGTCAAAAGCGAAAAACATGGACA
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272
Exon 11: 3UTRPDE
160873165 GRCh37
160793155 NCBI36
2795 
GATTTGATCTTTCTTTTTTTGTTAT C → T GAGGCTTTTGAAATGTGGAACTTGT
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
62
6
0
0.044
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272
Exon 11: 3UTRPDE
160873297 GRCh37
160793287 NCBI36
2927 
TATGCAAACAGGCAAAATTGGTACC A → G AAGGGAAACATTAACCATGAGGAAG
+ 
 
n=
A/A=
A/G=
G/G=
G=
134
56
9
2
0.097
134
46
21
0
0.157
136
63
5
0
0.037
136
54
14
0
0.103
n/a
0.000
PMT-272
Exon 11: 3UTRPDEA
160873364 GRCh37
160793354 NCBI36
2994 
GAACAGGTGACAATATACACATGTG C → T GCTAATCGTAAAATGAGCATCTTAG
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
50
17
1
0.140
136
68
0
0
0.000
136
67
1
0
0.007
136
66
2
0
0.015
n/a
0.000
PMT-272
Exon 11: 3UTRPDE
160873504 GRCh37
160793494 NCBI36
3134 
TTTATTCACAGTCACTTGCAGTTTT G → T CTTTTCTCTGCATTTCTCTGCTGTA
+ 
 
n=
G/G=
G/T=
T/T=
T=
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
136
66
2
0
0.015
n/a
0.000
PMT-272
Exon 11: 3UTRPDE
160873589 GRCh37
160793579 NCBI36
3219 
TGGATATTTTTGTTTGGTAACAATT A → AATT AAATTTTAAATCGTAAAAAATGTAC
+ 
 
n=
A/A=
A/AATT=
AATT/AATT=
AATT=
136
48
19
1
0.154
136
67
1
0
0.007
136
67
1
0
0.007
136
66
2
0
0.015
n/a
0.000
PMT-272
 PDE
160874337 GRCh37
160794327 NCBI36
  
ACACAAAAAATGCCGAGGTTTGGCG T → G AGCTGGTAGCTGGGGACAGTGTCTT
+ 
 
n=
T/T=
T/G=
G/G=
G=
136
68
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272
 PDE
160874381 GRCh37
160794371 NCBI36
  
GTGTCTTCGTTTGATTACTGCCAGT T → A ATTTCCAGCATGCTAAATCCCTACC
+ 
 
n=
T/T=
T/A=
A/A=
A=
136
61
6
1
0.059
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272
 PDE
160874438 GRCh37
160794428 NCBI36
  
CCAGCCTCTAGGTGAGTCAGTGCGT C → T ACTCTGTCTCCCGTCCAATTAATTA
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
68
0
0
0.000
136
68
0
0
0.000
136
65
3
0
0.022
136
68
0
0
0.000
n/a
0.000
PMT-272
 PDE
160874541 GRCh37
160794531 NCBI36
  
CACCAGGCTTATTGGGGCGTGCACA G → A CCAAGACCCCAAGAAGTGACTCCTT
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
64
4
0
0.029
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 PDE
160874589 GRCh37
160794579 NCBI36
  
CTTGTAAAATGTATTTGTCCTTCTC A → G AAGCAAACCAGAGGCCCTCCACTGT
+ 
 
n=
A/A=
A/G=
G/G=
G=
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272
 PDE
160874737 GRCh37
160794727 NCBI36
  
AATTGAAATTGGAAAGGAACTTATG G → A GCATATTACTGGAGCATCTGCAGTG
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
61
6
1
0.059
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272
 PDE
160874954 GRCh37
160794944 NCBI36
  
CTGTACCCTCTACCTCCTTCCCTGT C → T GGAAAAGTCACCACTTTAGTCCCTG
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
66
2
0
0.015
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272
 PDE
160874955 GRCh37
160794945 NCBI36
  
TGTACCCTCTACCTCCTTCCCTGTC G → A GAAAAGTCACCACTTTAGTCCCTGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
64
4
0
0.029
136
67
1
0
0.007
136
65
3
0
0.022
136
68
0
0
0.000
n/a
0.000
PMT-272
 PDE
160875009 GRCh37
160794999 NCBI36
  
CCAGCACACCCCAGGAGGGTGAGTG G → A CCTGAGGTAGTTACGGCACTTAAAA
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
66
2
0
0.015
136
67
1
0
0.007
136
66
2
0
0.015
136
68
0
0
0.000
n/a
0.000
PMT-272
 PDE
160875064 GRCh37
160795054 NCBI36
  
CTTGCTACCGATCTGGAACTCAAGC C → T CCAAGACATCCCCTTAGATGATCTG
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
67
1
0
0.007
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272
 PDE
160875149 GRCh37
160795139 NCBI36
  
AAACAACACTTAGACTGGGGTCTAA C → T GTTGACAAATCCTTCTAGAATTTGC
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
66
2
0
0.015
136
67
1
0
0.007
136
66
2
0
0.015
136
68
0
0
0.000
n/a
0.000
PMT-272
 PDE
160875453 GRCh37
160795443 NCBI36
  
GTTGCTGAACCCAAAACATGTTTAG G → A AGGAAAACCAGAAGAACAGAGCAGT
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
68
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
n/a
0.000
PMT-272
 PDE
160876051 GRCh37
160796041 NCBI36
  
TTTTATTGCAATAAAAAGAATAGTC G → A TCATTTACTAAGAATTAACCTTTTC
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
67
1
0
0.007
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272
 PDE
160876085 GRCh37
160796075 NCBI36
  
TAAGAATTAACCTTTTCAGGCACAA G → A CTCTTAATGTGGTGTATCTCACTTC
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
68
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.