UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:OCTN1
HGNC Symbol:SLC22A4
HGNC Description:solute carrier family 22 (organic cation/zwitterion transporter), member 4
HGNC ID:10968
Superfamily:SLC
Chromosome:Chr.5(+): 131630145-131679899 GRCh37
Location:5q31.1
OMIM:604190
OMIM Phenotype:Rheumatoid arthritis, susceptibility to; Crohn disease, susceptibility to
Accessions:AB007448
Nucleotide RefSeq:NM_003059
Protein RefSeq:NP_003050
Entrez:6583
Ensembl:ENSG00000197208
Isoforms:1
Evidence:None
Tissues:kidney, trachea, bone marrow, skeletal muscle, prostate, lung, pancreas, placenta, heart, uterus, spleen, spinal cord
Type:protein-coding
Sets:II,IV
PharmGKB ID:PA332
HPRD ID:09171
Substrates:TEA
Trivial Names:OCTN1
Transcripts:NM_003059.2 [Chr.5(+): 131630145-131679899 GRCh37]
ENST00000200652 [Chr.5(+): 131630136-131679899 GRCh37]
ENST00000425923 [Chr.5(+): 131657877-131663078 GRCh37]
ENST00000491257 [Chr.5(+): 131631118-131656665 GRCh37]
Annotation History:View Events (2)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC22A4.

Variant Data

View all PMT variants for SLC22A4 on UCSC Genome Browser
Showing SNP features for transcript: NM_003059  
SLC22A4 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC22A4 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
PromoterPDE
131629973 GRCh37
131657872 NCBI36
-172-337
CCAGCCTGGAAGCCCCCGTCAGGTC C → CGGGC TTGGGGGCGGGCGGGCGCGCGAAGC
+ 
 
n=
C/C=
C/CGGGC=
CGGGC/CGGGC=
CGGGC=
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
n/a
0.000
PMT-272
PromoterPDE
131630024 GRCh37
131657923 NCBI36
-121-286
ACAGGGCGGAGACAGCCGGGAGCCC A → T GCCTCCCGGGCTGGGCCGCCCTCCC
+ 
 
n=
A/A=
A/T=
T/T=
T=
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
n/a
0.000
PMT-272
PromoterPDE
131630054 GRCh37
131657953 NCBI36
-91-256

C → T, G
CCCGGGCTGGGCCGCCCTCCCCTTC C → G CCGCGCCGGGCCGGGGATGGGGGTG
CCCGGGCTGGGCCGCCCTCCCCTTC C → T CCGCGCCGGGCCGGGGATGGGGGTG
+ 

 
 
 
n=
C/C=
C/G=
G/G=
C/T=
T/T=
G/T=
G=
T=
136
68
0
0
0
0
0
0.000
0.000
136
67
0
0
1
0
0
0.000
0.007
136
66
2
0
0
0
0
0.015
0.000
134
67
0
0
0
0
0
0.000
0.000
n/a
0.000
0.000
PMT-272
PromoterPDE
131630062 GRCh37
131657961 NCBI36
-83-248
GGGCCGCCCTCCCCTTCCCCGCGCC G → C GGCCGGGGATGGGGGTGTGGTCCCA
+ 
 
n=
G/G=
G/C=
C/C=
C=
136
51
16
1
0.132
136
27
36
5
0.338
136
32
28
8
0.324
134
32
29
6
0.306
n/a
0.000
PMT-272
PromoterPDE
131630095 GRCh37
131657994 NCBI36
-50-215
GATGGGGGTGTGGTCCCAAGTGTAC A → G GTGGCATCAAGCTCAGCGCGAGCTC
+ 
 
n=
A/A=
A/G=
G/G=
G=
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
n/a
0.000
PMT-272
PromoterPDE
131630126 GRCh37
131658025 NCBI36
-19-184
ATCAAGCTCAGCGCGAGCTCCCGGG A → G ACGCTCCAACGCCTTCAGCCTGTTT
+ 
 
n=
A/A=
A/G=
G/G=
G=
136
68
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
134
67
0
0
0.000
n/a
0.000
PMT-272
Exon 1: 5UTRPDE
131630300 GRCh37
131658199 NCBI36
156-10
CCGTAGTTGCAAGTTTCGGAGCGGC A → T GTGGGAAGCATGCGGGACTACGACG
+ 
 
n=
A/A=
A/T=
T/T=
T=
160
78
2
0
0.013
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 1: CodingPDE
131630648 GRCh37
131658547 NCBI36
504339
TGGGGCAGCTGGAGCAGGAGAGCTG C → T CTGGATGGCTGGGAGTTCAGCCAGG
+113
Cys = Cys
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
160
79
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 2: CodingPDE
131647925 GRCh37
131675824 NCBI36
630465
CCCTGTTCTTCGTAGGCGTGCTCCT C → T GGCTCCTTCGTGTCCGGGCAGCTGT
+155
Leu = Leu
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
160
79
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 2: CodingPDEI
131647935 GRCh37
131675834 NCBI36
640475
CGTAGGCGTGCTCCTCGGCTCCTTC G → A TGTCCGGGCAGCTGTCAGACAGGTA
+159
Val → Met
(D=21)
n=
G/G=
G/A=
A/A=
A=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 2: CodingPDE1 pubI
131647954 GRCh37
131675853 NCBI36
659494
TCCTTCGTGTCCGGGCAGCTGTCAG A → G CAGGTAAGCACATGGGAGGGGAGGA
Reduced TEA and betaine uptake in transfected cells. PMID: 19940846.
+165
Asp → Gly
(D=94)
n=
A/A=
A/G=
G/G=
G=
160
80
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
131649300 GRCh37
131677199 NCBI36
  
TCTCATGTTTTGTGTTATACTGCAT T → C CTCTAGGTTTGGCAGGAAGAACGTT
+ 
 
n=
T/T=
T/C=
C/C=
C=
160
80
0
0
0.000
160
79
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 3: CodingPDEI
131649415 GRCh37
131677314 NCBI36
771606
AGATGTTCACTGTGTTATTTGTCAT C → T GTGGGCATGGGCCAGATCTCCAACT
+202
Ile = Ile
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 3: CodingPDE1 pubI
131649424 GRCh37
131677323 NCBI36
780615
CTGTGTTATTTGTCATCGTGGGCAT G → A GGCCAGATCTCCAACTATGTGGTAG
Reduced TEA and betaine uptake in transfected cells. PMID: 19940846.
+205
Met → Ile
(D=10)
n=
G/G=
G/A=
A/A=
A=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDEI
131658085 GRCh37
131685984 NCBI36
  
TCGTCCCCAGACAGGCCCTCTGCTG C → T GGGTCAGCACACCTGGAACACACCT
+ 
 
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
160
80
0
0
0.000
120
56
3
1
0.042
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 5: CodingPDEI
131662989 GRCh37
131690888 NCBI36
1009844
TTATAGGTTCATTCCTGAATCTCCC C → T GATGGCTGATATCCCAGAGAAGATT
Reduced TEA and betaine uptake in transfected cells. PMID: 19940846.
+282
Arg → STOP
n=
C/C=
C/T=
T/T=
T=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 5: CodingPDE6 pubsI
131663062 GRCh37
131690961 NCBI36
1082917
CAAAAAGCTGCAAAAATGAACAACA C → T AGCTGTACCAGCAGTGATATTTGAT
+306
Thr → Ile
(D=89)
n=
C/C=
C/T=
T/T=
T=
160
46
25
9
0.269
160
32
42
6
0.338
120
6
31
23
0.642
100
27
22
1
0.240
12
2
3
1
0.417
Set-II
 PDEI
131667353 GRCh37
131695252 NCBI36
  
TTCTAAGCATAGTCAAGGTGAAGTG A → G GAGTTGCATGCATAAGTTTTCCCCA
+ 
 
n=
A/A=
A/G=
G/G=
G=
160
79
1
0
0.006
160
69
11
0
0.069
120
58
2
0
0.017
100
48
2
0
0.020
12
6
0
0
0.000
Set-II
 PDE
131667356 GRCh37
131695255 NCBI36
  
TAAGCATAGTCAAGGTGAAGTGAGA G → T TTGCATGCATAAGTTTTCCCCATGC
+ 
 
n=
G/G=
G/T=
T/T=
T=
160
70
9
1
0.069
160
78
2
0
0.013
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDEIA
131667548 GRCh37
131695447 NCBI36
  
CATTATGTCTTTGCTGCTATGGTAA G → A TAATAAGTGACCTGGAAATGCAGAT
+ 
 
n=
G/G=
G/A=
A/A=
A=
160
72
8
0
0.050
160
72
7
1
0.056
120
30
26
4
0.283
100
49
1
0
0.010
12
5
1
0
0.083
Set-II
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 7: CodingPDE1 pubI
131670546 GRCh37
131698445 NCBI36
13471182
TTACAGCCTGGCTGCTATTGCGAAC G → C CTGCCCAGGCGTTATATCATAGCTG
+394
Thr = Thr
n=
G/G=
G/C=
C/C=
C=
160
33
35
12
0.369
160
30
41
9
0.369
120
4
26
30
0.717
100
26
23
1
0.250
12
1
3
2
0.583
Set-II
 PDE
131670644 GRCh37
131698543 NCBI36
  
CCTGTGGGTAAGAAGTTAACCAAGA T → C GAACAGCTTACCAGAAAAGACCCAC
+ 
 
n=
T/T=
T/C=
C/C=
C=
160
78
2
0
0.013
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE1 pubI
131671460 GRCh37
131699359 NCBI36
  
AGGACAATAAAAATAACTGATATAA G → A AAAGTATCACTTCTAAAAGCACCAT
+ 
 
n=
G/G=
G/A=
A/A=
A=
160
80
0
0
0.000
160
78
2
0
0.013
120
60
0
0
0.000
100
48
2
0
0.020
12
6
0
0
0.000
Set-II
 PDE
131671488 GRCh37
131699387 NCBI36
  
AGTATCACTTCTAAAAGCACCATTG T → A TTATACCGGGTCTCTTTTCCAGATT
+ 
 
n=
T/T=
T/A=
A/A=
A=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 8: CodingPDEI
131671662 GRCh37
131699561 NCBI36
15781413
TCACATCCACGGCCTCCAGAGTGGG C → G AGCATCATTGCCCCCTACTTTGTTT
+471
Gly = Gly
n=
C/C=
C/G=
G/G=
G=
160
76
4
0
0.025
160
73
5
2
0.056
120
60
0
0
0.000
100
46
4
0
0.040
12
6
0
0
0.000
Set-II
 PDEIA
131671769 GRCh37
131699668 NCBI36
  
AAAAGTAAGATTTTCATTGTGAAAA T → C GTCAAATAGCATAGAATGTACTGGA
+ 
 
n=
T/T=
T/C=
C/C=
C=
160
6
23
51
0.781
160
7
32
41
0.713
120
10
27
23
0.608
100
1
21
28
0.770
12
2
2
2
0.500
Set-II
Exon 9: CodingPDE14 pubsI
131676320 GRCh37
131704219 NCBI36
16721507
TAGTCTGACTGTCCTGATTGGAATC T → C TCACCCTTTTTTTCCCTGAAAGTTT
Higher gabapentin exposure and lower renal clearance/tubular scretion in individuals carrying OCTN1 variant. PMID: 19940846.
+503
Phe → Leu
(D=22)
n=
T/T=
T/C=
C/C=
C=
160
0
14
66
0.912
160
10
46
24
0.588
120
0
0
60
1.000
100
3
17
30
0.770
12
0
0
6
1.000
Set-II
Exon 10: 3UTRPDEI
131679531 GRCh37
131707430 NCBI36
1824 
AGGTTCTAATAACTGCATTCTGAAA A → G AATATCTACCCCATTTGGTGAAGTG
+ 
 
n=
A/A=
A/G=
G/G=
G=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 10: 3UTRPDE
131679621 GRCh37
131707520 NCBI36
1914 
TCCCACTGAAATGGACTGACTGTAA C → T GATTGACACCAAAATGAACCTTGCT
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
136
66
2
0
0.015
n/a
0.000
PMT-272
Exon 10: 3UTRPDE
131679747 GRCh37
131707646 NCBI36
2040 
TTCTAGAGAGTCTCCTTACTCATTA A → C TTCAATGAAATGGATTGGTAAGATG
+ 
 
n=
A/A=
A/C=
C/C=
C=
136
66
2
0
0.015
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272
 PDE
131679920 GRCh37
131707819 NCBI36
  
AACAATGTGTGTGTATGTGTGTGTG T → TGT TTGTACATGTGGAAGTGAACCAGCA
+ 
 
n=
T/T=
T/TGT=
TGT/TGT=
TGT=
136
67
1
0
0.007
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272
 PDE
131679946 GRCh37
131707845 NCBI36
  
TTGTACATGTGGAAGTGAACCAGCA C → A AGTCAAAATTATAGTAGTTTCTGAA
+ 
 
n=
C/C=
C/A=
A/A=
A=
134
51
16
0
0.119
134
67
0
0
0.000
136
65
3
0
0.022
136
66
2
0
0.015
n/a
0.000
PMT-272
 PDEI
131679995 GRCh37
131707894 NCBI36
  
AAGTGAACCAAATGATTATATGCAG T → A ATTCCTATCCAGAAAACCTTCCACA
+ 
 
n=
T/T=
T/A=
A/A=
A=
134
60
7
0
0.052
134
58
7
2
0.082
134
31
32
4
0.299
136
65
3
0
0.022
n/a
0.000
PMT-272
 PDEI
131680004 GRCh37
131707903 NCBI36
  
AAATGATTATATGCAGTATTCCTAT C → T CAGAAAACCTTCCACACTCCTTTGA
+ 
 
n=
C/C=
C/T=
T/T=
T=
134
66
1
0
0.007
134
66
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.