UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:OCTN2
HGNC Symbol:SLC22A5
HGNC Description:solute carrier family 22 (organic cation/carnitine transporter), member 5
HGNC ID:10969
Superfamily:SLC
Chromosome:Chr.5(+): 131705396-131731306 GRCh37
Location:5q23.3
OMIM:603377
OMIM Phenotype:Carnitine deficiency, systemic primary; Crohn disease, susceptibility to
Accessions:AF057164
Nucleotide RefSeq:NM_003060
Protein RefSeq:NP_003051
Entrez:6584
Ensembl:ENSG00000197375
Isoforms:3
Evidence:None
Tissues:heart, placenta, skeletal muscle, kidney, pancreas, brain, lung, liver
Type:protein-coding
Sets:II,IV
PharmGKB ID:PA333
HPRD ID:04539
Substrates:acetyl-L-carnitine, L-carnitine, D-carnitine, cephaloridine, cefepime, cefoselis
Trivial Names:CDSP, OCTN2, OCTN2VT
Transcripts:NM_003060.3 [Chr.5(+): 131705401-131731306 GRCh37]
XM_005272055.1 [Chr.5(+): 131705396-131731303 GRCh37]
XM_005272056.1 [Chr.5(+): 131705983-131731303 GRCh37]
ENST00000245407 [Chr.5(+): 131705444-131731306 GRCh37]
ENST00000415928 [Chr.5(+): 131705968-131722843 GRCh37]
ENST00000435065 [Chr.5(+): 131705665-131729964 GRCh37]
ENST00000437841 [Chr.5(+): 131705592-131724697 GRCh37]
ENST00000447841 [Chr.5(+): 131724603-131730444 GRCh37]
ENST00000448810 [Chr.5(+): 131721020-131729507 GRCh37]
ENST00000461013 [Chr.5(+): 131711778-131731303 GRCh37]
ENST00000475308 [Chr.5(+): 131724652-131731305 GRCh37]
ENST00000479605 [Chr.5(+): 131723505-131729375 GRCh37]
Annotation History:View Events (18)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC22A5.

Variant Data

View all PMT variants for SLC22A5 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC22A5 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC22A5 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
PromoterPDE
131705219 GRCh37
131733118 NCBI36
-182-446
CCGCCCGGCGCTAGAGGAGCGAGTT C → T GGACTCGGACCCCAAGGCCTCGAGT
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
68
0
0
0.000
132
66
0
0
0.000
128
62
0
2
0.031
112
56
0
0
0.000
n/a
0.000
PMT-272
PromoterPDE
131705266 GRCh37
131733165 NCBI36
-135-399
GAGTCCCGCTGCCTTCCTAAGCCGA G → C CCCGGGCTACCTCGGTCGTCCCCAG
+ 
 
n=
G/G=
G/C=
C/C=
C=
136
36
21
11
0.316
132
25
35
6
0.356
128
30
12
22
0.438
112
27
24
5
0.304
n/a
0.000
PMT-272
PromoterPDE
131705273 GRCh37
131733172 NCBI36
-128-392
GCTGCCTTCCTAAGCCGAGCCCGGG C → T TACCTCGGTCGTCCCCAGCAGGCTT
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
68
0
0
0.000
132
66
0
0
0.000
128
64
0
0
0.000
112
55
1
0
0.009
n/a
0.000
PMT-272
PromoterPDE
131705297 GRCh37
131733196 NCBI36
-104-368
GCTACCTCGGTCGTCCCCAGCAGGC T → G TGGCTGGCAGAGGCCGGGCCTCGCC
+ 
 
n=
T/T=
T/G=
G/G=
G=
136
35
22
11
0.324
132
25
35
6
0.356
128
30
12
22
0.438
112
27
25
4
0.295
n/a
0.000
PMT-272
PromoterPDE
131705346 GRCh37
131733245 NCBI36
-55-319
CCAGGTCCCCAGGACAGGCCCCGCC C → A GGGCCTCAGGTGCACTCCCGGCCCG
+ 
 
n=
C/C=
C/A=
A/A=
A=
136
68
0
0
0.000
132
63
3
0
0.023
128
64
0
0
0.000
112
56
0
0
0.000
n/a
0.000
PMT-272
Promoter
Exon 1: 5UTR
PDE
131705431 GRCh37
131733330 NCBI36
31-234
TCGCCGGCGCCGCTCTGCCTGCCAG C → G GGGGCGCGCCTTGCGGCCCAGGCCC
+ 
 
n=
C/C=
C/G=
G/G=
G=
136
68
0
0
0.000
132
66
0
0
0.000
128
55
6
3
0.094
112
54
2
0
0.018
n/a
0.000
PMT-272
Exon 1: 5UTRPDE10 pubs
131705458 GRCh37
131733357 NCBI36
58-207
GGGCGCGCCTTGCGGCCCAGGCCCG C → G AACCTTCCCTGGTCGTGCGCCCTAT
No appreciable effect of this variant on carnitine disposition. PMID: 19940846.
+ 
 
n=
C/C=
C/G=
G/G=
G=
136
12
28
28
0.618
132
17
32
17
0.500
128
0
0
64
1.000
112
6
24
26
0.679
n/a
0.000
PMT-272
Exon 1: 5UTRPDE
131705516 GRCh37
131733415 NCBI36
116-149
CAGCCGCGGCAGGACCAAGGCGGCG G → A TGTCAGCTCGCGAGCCTACCCTCCG
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
68
0
0
0.000
132
64
1
1
0.023
128
64
0
0
0.000
112
56
0
0
0.000
n/a
0.000
PMT-272
Exon 1: 5UTRPDE
131705526 GRCh37
131733425 NCBI36
126-139
AGGACCAAGGCGGCGGTGTCAGCTC G → T CGAGCCTACCCTCCGCGGACGGTCT
+ 
 
n=
G/G=
G/T=
T/T=
T=
136
68
0
0
0.000
132
66
0
0
0.000
128
62
0
2
0.031
112
56
0
0
0.000
n/a
0.000
PMT-272
Exon 1: CodingPDE1 pub
131705715 GRCh37
131733614 NCBI36
31551
CCTTCCTGGGCGAGTGGGGGCCCTT C → G CAGCGCCTCATCTTCTTCCTGCTCA
Reduced TEA and L-carnitine uptake in transfected cells. PMID: 19940846.
+17
Phe → Leu
(D=22)
n=
C/C=
C/G=
G/G=
G=
160
80
0
0
0.000
160
80
0
0
0.000
120
58
2
0
0.017
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 1: CodingPDE
131705949 GRCh37
131733848 NCBI36
549285
CCACCATCGCCAACTTCTCGGCGCT C → T GGGCTGGAGCCGGGGCGCGACGTGG
+95
Leu = Leu
n=
C/C=
C/T=
T/T=
T=
160
14
34
32
0.613
160
9
39
32
0.644
120
29
27
4
0.292
100
1
23
26
0.750
12
2
3
1
0.417
Set-II
 PDE
131706074 GRCh37
131733973 NCBI36
  
GTGACCGAGGTGGGTGCCGGCCCCT G → A CTGGGGCTGAGACCAGGGCTCGGAG
+ 
 
n=
G/G=
G/A=
A/A=
A=
160
66
12
2
0.100
160
78
2
0
0.013
120
56
4
0
0.033
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
Exon 2: CodingPDE2 pubsIA
131714106 GRCh37
131742005 NCBI36
694430
GTGTGAGGACGACTGGAAGGCCCCA C → T TCACAATCTCCTTGTTCTTCGTGGG
+144
Leu → Phe
(D=22)
n=
C/C=
C/T=
T/T=
T=
160
69
10
1
0.075
160
80
0
0
0.000
120
60
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
Exon 4: CodingPDEI
131721174 GRCh37
131749073 NCBI36
1071807
TGGCGCTGACGATGCCGGGGGTGCT G → A TGCGTGGCACTCTGGTGGTGAGTGT
+269
Leu = Leu
n=
G/G=
G/A=
A/A=
A=
160
14
34
32
0.613
160
9
39
32
0.644
116
28
26
4
0.293
100
1
23
26
0.750
12
2
3
1
0.417
Set-II
 PDEI
131721204 GRCh37
131749103 NCBI36
  
TGGCACTCTGGTGGTGAGTGTGACC C → T TGTGCCCCATGTGCCCACTGGCAGG
+ 
 
n=
C/C=
C/T=
T/T=
T=
160
14
34
32
0.613
160
9
39
32
0.644
116
28
26
4
0.293
100
1
23
26
0.750
12
2
3
1
0.417
Set-II
 PDE
131721229 GRCh37
131749128 NCBI36
  
CTGTGCCCCATGTGCCCACTGGCAG G → T ATGATTTCTGTCTGGCCTTCACTAG
+ 
 
n=
G/G=
G/T=
T/T=
T=
160
80
0
0
0.000
160
80
0
0
0.000
116
55
2
1
0.034
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
131722650 GRCh37
131750549 NCBI36
  
AACCTTATTCCCACCTATGGCTGTG C → G TCTACCTGGTCTGTGGGTCTGCTGT
+ 
 
n=
C/C=
C/G=
G/G=
G=
160
80
0
0
0.000
160
80
0
0
0.000
120
57
3
0
0.025
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
131728087 GRCh37
131755986 NCBI36
  
CTCTCAATAGCTGCATGCCATGGGT T → - GGTACCTACTCCTACCCTCTTTCCT
+ 
 
n=
T/T=
T/-=
-/-=
-=
160
78
2
0
0.013
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
131728091 GRCh37
131755990 NCBI36
  
CAATAGCTGCATGCCATGGGTTGGT A → G CCTACTCCTACCCTCTTTCCTTTGC
+ 
 
n=
A/A=
A/G=
G/G=
G=
160
64
14
2
0.113
160
78
2
0
0.013
120
56
4
0
0.033
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
Exon 8: CodingPDE3 pubsI
131728202 GRCh37
131756101 NCBI36
16091345
GGCTGCCTTTTCCATGGTCTACGTG T → G ACACAGCCGAGCTGTATCCCACAGT
Altered substrate specificity in transfected cells. PMID: 19940846.
+449
Tyr → Asp
(D=160)
n=
T/T=
T/G=
G/G=
G=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 8: CodingPDE2 pubs
131728298 GRCh37
131756197 NCBI36
17051441

G → A, T
GGGCAGCATCCTGTCTCCCTACTTC G → A TTTACCTTGGTAAGTCCCATGAGCC
GGGCAGCATCCTGTCTCCCTACTTC G → T TTTACCTTGGTAAGTCCCATGAGCC
Reduced TEA and L-carnitine uptake in transfected cells. PMID: 19940846.
+481

 
Val → Ile
(D=29)
Val → Phe
(D=50)
n=
G/G=
G/A=
A/A=
G/T=
T/T=
A/T=
A=
T=
160
79
1
0
0
0
0
0.006
0.000
160
79
0
0
1
0
0
0.000
0.006
120
60
0
0
0
0
0
0.000
0.000
100
50
0
0
0
0
0
0.000
0.000
12
6
0
0
0
0
0
0.000
0.000
Set-II
 PDE
131728325 GRCh37
131756224 NCBI36
  
TTACCTTGGTAAGTCCCATGAGCCA A → G GGGCACACTAGAGCAACGGGATGGA
+ 
 
n=
A/A=
A/G=
G/G=
G=
160
80
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
131728336 GRCh37
131756235 NCBI36
  
AGTCCCATGAGCCAAGGGCACACTA G → C AGCAACGGGATGGAAGTACTAACTG
+ 
 
n=
G/G=
G/C=
C/C=
C=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 9: CodingPDEI
131729439 GRCh37
131757338 NCBI36
17861522
CATCCTGACAGCCATCCTCACCTTG T → C TTCTCCCAGAGAGCTTCGGTACCCC
+508
Phe → Leu
(D=22)
n=
T/T=
T/C=
C/C=
C=
160
80
0
0
0.000
160
80
0
0
0.000
120
60
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
 PDE
131729839 GRCh37
131757738 NCBI36
  
TTTGGAGACTGGGAGGCATCTTTTT A → C AAATGTGTTACTGACATATTTTTGC
+ 
 
n=
A/A=
A/C=
C/C=
C=
160
64
14
2
0.113
160
78
2
0
0.013
120
56
4
0
0.033
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
Exon 10: CodingPDE1 pubI
131729878 GRCh37
131757777 NCBI36
18521588
ACATATTTTTGCTTGTTTTTATAGA A → G TGAAACACAGAAAAACTCCAAGTCA
+530
Met → Val
(D=21)
n=
A/A=
A/G=
G/G=
G=
160
80
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 10: CodingPDE2 pubsI
131729935 GRCh37
131757834 NCBI36
19091645
GATGTTAAAAGATGGTCAAGAAAGG C → T CCACAATCCTTAAAAGCACAGCCTT
+549
Pro → Ser
(D=74)
n=
C/C=
C/T=
T/T=
T=
160
66
12
2
0.100
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 10: 3UTRPDEI
131730011 GRCh37
131757910 NCBI36
1985 
AACTGAAGAGGAAAGACTGTCTTGC C → T AGAAATGGCCAGCTTGTGCAGACTC
+ 
 
n=
C/C=
C/T=
T/T=
T=
160
78
2
0
0.013
160
65
15
0
0.094
120
60
0
0
0.000
100
47
3
0
0.030
12
6
0
0
0.000
Set-II
Exon 10: 3UTR
131730053 GRCh37
131757952 NCBI36
2027 
TGCAGACTCCGAGTCCTTCAGTGAC A → AA AAAGGCCTTTGCTGTTTGTCCTCTT
+ 
 
n=
A/A=
A/AA=
AA/AA=
AA=
136
28
28
12
0.382
134
47
18
2
0.164
136
53
15
0
0.110
136
46
20
2
0.176
n/a
0.000
PMT-272
Exon 10: 3UTRPDE
131730167 GRCh37
131758066 NCBI36
2141 
CACCACCTTCCTCTAGGGACACTGG G → T GCTACCTACAGACAACTTCATCTAA
+ 
 
n=
G/G=
G/T=
T/T=
T=
136
68
0
0
0.000
134
67
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
n/a
0.000
PMT-272
Exon 10: 3UTRPDE
131730235 GRCh37
131758134 NCBI36
2209 
GATGGACTCAGCACCTCCAAAGCAG T → G TAATTTTTCACTAGAACCAGTGAGA
+ 
 
n=
T/T=
T/G=
G/G=
G=
136
67
1
0
0.007
134
67
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272
Exon 10: 3UTRPDE
131730498 GRCh37
131758397 NCBI36
2472 
CAGGGCAGGAGAGCGCAGAGCTAGG G → C AAAGTGAAAGGTAATGAAGATGGAG
+ 
 
n=
G/G=
G/C=
C/C=
C=
136
67
1
0
0.007
134
67
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272
Exon 10: 3UTRPDE
131730508 GRCh37
131758407 NCBI36
2482 
GAGCGCAGAGCTAGGGAAAGTGAAA G → A GTAATGAAGATGGAGCAGAATGAGC
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
68
0
0
0.000
134
67
0
0
0.000
136
68
0
0
0.000
136
66
2
0
0.015
n/a
0.000
PMT-272
Exon 10: 3UTRPDE
131730564 GRCh37
131758463 NCBI36
2538 
CAGATCACCAGCAAAGTGCACTGAT G → C TGTGAGCTCTTAAGACCACTCAGCA
+ 
 
n=
G/G=
G/C=
C/C=
C=
136
68
0
0
0.000
134
67
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
n/a
0.000
PMT-272
Exon 10: 3UTRPDE
131730642 GRCh37
131758541 NCBI36
2616 
TGATCAAAGCACTGGGCTTGTCCAG G → T CTCATAATAAATGCTCCATTGAATC
+ 
 
n=
G/G=
G/T=
T/T=
T=
136
68
0
0
0.000
134
65
2
0
0.015
136
68
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272
Exon 10: 3UTRPDEI
131730807 GRCh37
131758706 NCBI36
2781 
AAGCTGTAATGTGGGTTTTGTTTTA T → C TGTTTATTTGTTTGTTGTTGTATCC
+ 
 
n=
T/T=
T/C=
C/C=
C=
134
16
29
22
0.545
136
2
18
48
0.838
136
0
15
53
0.890
132
2
19
45
0.826
n/a
0.000
PMT-272
Exon 10: 3UTRPDE
131730907 GRCh37
131758806 NCBI36
2881 
CCTTAGCCTCCTGGTTTGTGTCTTT T → C TTTTTTTTTTTTTAAAACAGAATCA
+ 
 
n=
T/T=
T/C=
C/C=
C=
134
67
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
132
66
0
0
0.000
n/a
0.000
PMT-272
Exon 10: 3UTRPDE
131730923 GRCh37
131758822 NCBI36
2897 
TGTGTCTTTTTTTTTTTTTTTTTAA A → AC ACAGAATCACTCTGGCAATTGTCTG
+ 
 
n=
A/A=
A/AC=
AC/AC=
AC=
134
12
27
28
0.619
132
1
17
48
0.856
136
0
15
53
0.890
128
2
17
45
0.836
n/a
0.000
PMT-272
Exon 10: 3UTRPDE
131731001 GRCh37
131758900 NCBI36
2975 
AGCCCTAGCCTCTAGCACTTCTCTA AGTGCCAAAAAC → - AGTGTCATTGTGTG
+ 
 
n=
AGTGCCAAAAAC/AGTGCCAAAAAC=
AGTGCCAAAAAC/-=
-/-=
-=
134
67
0
0
0.000
136
66
2
0
0.015
136
68
0
0
0.000
132
64
2
0
0.015
n/a
0.000
PMT-272
Exon 10: 3UTRPDE
131731106 GRCh37
131759005 NCBI36
3080 
TTGTGTTCATAGTCTTTCAGAGTAG C → T TCACTTTAGTCCTGTAACTTTATTG
+ 
 
n=
C/C=
C/T=
T/T=
T=
134
67
0
0
0.000
136
66
2
0
0.015
136
68
0
0
0.000
132
65
1
0
0.008
n/a
0.000
PMT-272
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 10: 3UTRPDE
131731143 GRCh37
131759042 NCBI36
3117 
CTGTAACTTTATTGGGTGATATTTT G → T TGTTCAGTGTAATTGTCTTCTCTTT
+ 
 
n=
G/G=
G/T=
T/T=
T=
134
51
16
0
0.119
136
68
0
0
0.000
136
68
0
0
0.000
132
66
0
0
0.000
n/a
0.000
PMT-272
Exon 10: 3UTRPDEIA
131731304 GRCh37
131759203 NCBI36
3278 
AATAAGTAAAATGATTTTTTAAATA A → T CAGCAACTGCCTAGAATCTTTATTT
+ 
 
n=
A/A=
A/T=
T/T=
T=
134
16
29
22
0.545
136
2
18
48
0.838
136
0
15
53
0.890
132
2
19
45
0.826
n/a
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.