UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:OAT1
HGNC Symbol:SLC22A6
HGNC Description:solute carrier family 22 (organic anion transporter), member 6
HGNC ID:10970
Superfamily:SLC
Chromosome:Chr.11(-): 62744069-62752495 GRCh37
Location:11q12.3
OMIM:607582
OMIM Phenotype:None
Accessions:AF097490
Nucleotide RefSeq:NM_004790
Protein RefSeq:NP_004781
Entrez:9356
Ensembl:ENSG00000197901
Isoforms:4
Evidence:None
Tissues:kidney, brain, skeletal muscle
Type:protein-coding
Sets:II,IV
PharmGKB ID:PA388
HPRD ID:12125
Substrates:acyclovir, adefovir, p-aminohippurate, AZT, 6-carboxyfluorescein, cidofovir, cidofovir prodrug, fluorescein, ganciclovir, glutarate, indole acetate, indoxyl sulfate, ochratoxin A, 9-(2-phosphonylmethoxyethyl)diaminopurine (PMEDAP), 9-(2-phosphonylmethoxyethyl)guanidine (PMEG), prostaglandin E2, prostaglandin F2alpha, tetracycline
Trivial Names:OAT1, PAHT, HOAT1, ROAT1
Transcripts:NM_004790.4 [Chr.11(-): 62744069-62752495 GRCh37]
NM_153276.2 [Chr.11(-): 62744069-62752495 GRCh37]
NM_153277.2 [Chr.11(-): 62744069-62752495 GRCh37]
NM_153278.2 [Chr.11(-): 62744069-62752495 GRCh37]
ENST00000360421 [Chr.11(-): 62744069-62752455 GRCh37]
ENST00000377871 [Chr.11(-): 62744074-62752429 GRCh37]
ENST00000421062 [Chr.11(-): 62744266-62752162 GRCh37]
ENST00000458333 [Chr.11(-): 62744266-62752162 GRCh37]
ENST00000537349 [Chr.11(-): 62747340-62751364 GRCh37]
ENST00000540654 [Chr.11(-): 62703857-62752296 GRCh37]
Annotation History:View Events (8)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC22A6.

Variant Data

View all PMT variants for SLC22A6 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC22A6 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC22A6 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
PromoterPDE
62752640 GRCh37
62509216 NCBI36
-145-478
TCCAATAGATCCCACTCTGGCCCCC C → G CTGCCCCCAGATGCCCCCCTAATAC
- 
 
n=
C/C=
C/G=
G/G=
G=
134
65
2
0
0.015
128
53
11
0
0.086
136
68
0
0
0.000
126
58
5
0
0.040
n/a
0.000
PMT-272
PromoterPDE
62752587 GRCh37
62509163 NCBI36
-92-425
CCCTCTCCCTGCTCCTATTCAGTCC A → G CCCTCTCCTGCCCTTTATAACCACT
- 
 
n=
A/A=
A/G=
G/G=
G=
134
65
2
0
0.015
128
53
11
0
0.086
136
68
0
0
0.000
126
58
4
1
0.048
n/a
0.000
PMT-272
Exon 1: 5UTR
Promoter
PDE
62752457 GRCh37
62509033 NCBI36
39-295
CAGGCCAAGGATTAAAAACTGCCCA T → C GCAAGGGTCAGGTCTCCAGCAGACC
- 
 
n=
T/T=
T/C=
C/C=
C=
134
67
0
0
0.000
128
64
0
0
0.000
136
68
0
0
0.000
126
62
1
0
0.008
n/a
0.000
PMT-272
Exon 1: 5UTRPDE
62752440 GRCh37
62509016 NCBI36
56-278
ACTGCCCATGCAAGGGTCAGGTCTC C → T AGCAGACCCTGAAAGCTGAGCTGCC
- 
 
n=
C/C=
C/T=
T/T=
T=
134
67
0
0
0.000
128
63
1
0
0.008
136
68
0
0
0.000
126
62
1
0
0.008
n/a
0.000
PMT-272
Exon 1: 5UTRPDE
62752182 GRCh37
62508758 NCBI36
314-20
GACTGGAAGGCCTCAGCCCCCAGCC A → G CTGGGCTGGGCCTGGCCCAATGGCC
- 
 
n=
A/A=
A/G=
G/G=
G=
158
39
31
9
0.310
160
63
16
1
0.113
118
28
25
6
0.314
100
36
12
2
0.160
12
4
1
1
0.250
Set-II
Exon 1: CodingPDE1 pub
62752014 GRCh37
62508590 NCBI36
482149
GCTGCCATCCCTACCCACCACTGCC G → A CCCGCCTGCCGATGCCAACCTCAGC
-50
Arg → His
(D=29)
n=
G/G=
G/A=
A/A=
A=
158
74
5
0
0.032
160
80
0
0
0.000
120
60
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
Exon 1: CodingPDEI
62751983 GRCh37
62508559 NCBI36
513180
CTGCCGATGCCAACCTCAGCAAGAA C → T GGGGGGCTGGAGGTCTGGCTGCCCC
-60
Asn = Asn
n=
C/C=
C/T=
T/T=
T=
158
79
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
12
5
1
0
0.083
Set-II
Exon 1: CodingPDE
62751977 GRCh37
62508553 NCBI36
519186
ATGCCAACCTCAGCAAGAACGGGGG G → A CTGGAGGTCTGGCTGCCCCGGGACA
-62
Gly = Gly
n=
G/G=
G/A=
A/A=
A=
158
79
0
0
0.000
160
79
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 1: CodingPDEI
62751911 GRCh37
62508487 NCBI36
585252
AGTCCTGCCTCCGCTTCACCTCCCC G → T CAGTGGGGACTGCCCTTTCTCAATG
-84
Pro = Pro
n=
G/G=
G/T=
T/T=
T=
158
75
4
0
0.025
160
68
12
0
0.075
120
58
2
0
0.017
100
48
2
0
0.020
12
6
0
0
0.000
Set-II
Exon 1: CodingPDEI
62751852 GRCh37
62508428 NCBI36
644311
GCCAATGGCACAGGGGCCACAGAGC C → T CTGCACCGATGGCTGGATCTATGAC
-104
Pro → Leu
(D=98)
n=
C/C=
C/T=
T/T=
T=
158
78
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 1: CodingPDE
62751812 GRCh37
62508388 NCBI36
684351
GGATCTATGACAACAGCACCTTCCC A → G TCTACCATCGTGACTGAGGTGAGCA
-117
Pro = Pro
n=
A/A=
A/G=
G/G=
G=
158
75
4
0
0.025
160
68
12
0
0.075
120
58
2
0
0.017
100
48
2
0
0.020
12
6
0
0
0.000
Set-II
 PDE
62751551 GRCh37
62508127 NCBI36
  
AGGGGATTCTCTGAAGCCAGGCTCA T → C CTCTGCCTGACCCTTGCTCCTCTCC
- 
 
n=
T/T=
T/C=
C/C=
C=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
98
49
0
0
0.000
12
6
0
0
0.000
Set-II
 PDEA
62749590 GRCh37
62506166 NCBI36
  
ACCCTGGCACTCAACTTACTCGATG C → T ATTTTCCACTGAGCCTTGGGACAGG
- 
 
n=
C/C=
C/T=
T/T=
T=
158
75
4
0
0.025
160
68
12
0
0.075
118
57
2
0
0.017
100
48
2
0
0.020
12
6
0
0
0.000
Set-II
 PDEA
62749494 GRCh37
62506070 NCBI36
  
AGGTAGTTGCAGCATCCTGTCTTAA C → T CCTCTTTCCAGATGTGGAGTGGATG
- 
 
n=
C/C=
C/T=
T/T=
T=
160
60
18
2
0.138
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 4: CodingPDEI
62749434 GRCh37
62506010 NCBI36
1010677
ACACGGGCCTGCGTGGGCACCTTGA T → C TGGCTATGTCTACAGCCTGGGCCAG
-226
Ile → Thr
(D=89)
n=
T/T=
T/C=
C/C=
C=
160
80
0
0
0.000
160
79
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 4: CodingPDEI
62749344 GRCh37
62505920 NCBI36
1100767
CGCCACCTGCAGCTACTGGTCTCTG C → T GCCTTTTTTTGCCTTCTTCATCTAC
-256
Ala → Val
(D=64)
n=
C/C=
C/T=
T/T=
T=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
62748912 GRCh37
62505488 NCBI36
  
CCTAGAAAGCCCAGCCCCAGCCCCC C → G ACCCAGCTGACTGGAACTGAAGCCA
- 
 
n=
C/C=
C/G=
G/G=
G=
154
77
0
0
0.000
156
77
1
0
0.006
112
56
0
0
0.000
96
48
0
0
0.000
10
5
0
0
0.000
Set-II
 PDE
62748870 GRCh37
62505446 NCBI36
  
CTGAAGCCATGCTGACACCCACCCC C → T ACCCCCGCTCCCAGGTTCTTCATTG
- 
 
n=
C/C=
C/T=
T/T=
T=
154
77
0
0
0.000
156
78
0
0
0.000
112
55
1
0
0.009
96
48
0
0
0.000
10
5
0
0
0.000
Set-II
 PDE
62748863 GRCh37
62505439 NCBI36
  
CATGCTGACACCCACCCCCACCCCC G → A CTCCCAGGTTCTTCATTGAGTCGGC
- 
 
n=
G/G=
G/A=
A/A=
A=
154
77
0
0
0.000
156
78
0
0
0.000
112
55
1
0
0.009
96
48
0
0
0.000
10
5
0
0
0.000
Set-II
Exon 5: Coding
62748801 GRCh37
62505377 NCBI36
1185852
CCTCCTCCGGGAGGCTGGACCTCAC A → C CTGAGGGCCCTGCAGAGAGTCGCCC
-284
Thr = Thr
n=
A/A=
A/C=
C/C=
C=
154
0
0
77
1.000
156
0
0
78
1.000
112
0
0
56
1.000
96
0
0
48
1.000
10
0
0
5
1.000
Set-II
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 5: CodingPDE1 pub
62748776 GRCh37
62505352 NCBI36
1210877
ACTGAGGGCCCTGCAGAGAGTCGCC C → T GGATCAATGGGAAGCGGGAAGAAGG
-293
Arg → Trp
(D=101)
n=
C/C=
C/T=
T/T=
T=
154
74
3
0
0.019
156
78
0
0
0.000
112
56
0
0
0.000
96
48
0
0
0.000
10
5
0
0
0.000
Set-II
 PDEI
62748699 GRCh37
62505275 NCBI36
  
CCCCTGAGACTTCCCATGATAACCT C → T CCAGGGCTTCACCCCCAAACCCCAA
- 
 
n=
C/C=
C/T=
T/T=
T=
154
77
0
0
0.000
156
78
0
0
0.000
112
37
15
4
0.205
96
48
0
0
0.000
10
4
1
0
0.100
Set-II
 PDE
62748601 GRCh37
62505177 NCBI36
  
TGGGAGGAGCTCCTTGGGAGGATCC C → T GGGCCCTGAGCTCTGCCGGTCCCAG
- 
 
n=
C/C=
C/T=
T/T=
T=
154
58
17
2
0.136
158
79
0
0
0.000
116
58
0
0
0.000
100
50
0
0
0.000
10
5
0
0
0.000
Set-II
 PDE
62748440 GRCh37
62505016 NCBI36
  
CATGCTGTGGTAGGCCCAGAAAGAC A → C GACAGACTGAGACAAAAGGCTGGCT
- 
 
n=
A/A=
A/C=
C/C=
C=
154
77
0
0
0.000
158
79
0
0
0.000
116
58
0
0
0.000
100
49
1
0
0.010
10
5
0
0
0.000
Set-II
 PDE
62748416 GRCh37
62504992 NCBI36
  
CAGACAGACTGAGACAAAAGGCTGG C → T TGGGGCAGGAGGAGACACAATGGGT
- 
 
n=
C/C=
C/T=
T/T=
T=
154
77
0
0
0.000
158
79
0
0
0.000
116
57
1
0
0.009
100
50
0
0
0.000
10
5
0
0
0.000
Set-II
 PDE
62747434 GRCh37
62504010 NCBI36
  
TTCCTAACAAACTCCATACTCCTCT C → T TTCTCTCTGCTAGGTTTGCCACTAG
- 
 
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
160
80
0
0
0.000
118
58
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 7: CodingPDE
62747225 GRCh37
62503801 NCBI36
15661233
TGCTGGCAGGCATCTGCATCCTGCT C → T AATGGGGTGATACCCCAGGGTGAGC
-411
Leu = Leu
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
160
80
0
0
0.000
118
58
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
62747194 GRCh37
62503770 NCBI36
  
GGTGATACCCCAGGGTGAGCACCCA C → T GAGCACCTTGGCCCCTTCTCCTCAG
- 
 
n=
C/C=
C/T=
T/T=
T=
160
79
1
0
0.006
160
80
0
0
0.000
118
59
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
62747145 GRCh37
62503721 NCBI36
  
AGCCCCATCCCCACACATAACCCAA T → C ATCTCAGAAGGGAGGGGGCCAATTC
- 
 
n=
T/T=
T/C=
C/C=
C=
160
0
6
74
0.963
160
0
0
80
1.000
118
0
0
59
1.000
100
0
0
50
1.000
12
0
0
6
1.000
Set-II
Exon 8: CodingPDE1 pub
62746960 GRCh37
62503536 NCBI36
16941361
GGGGAACTGTATCCCACAATGATCC G → A GTGAGTGGGAGCCTAATGGGAGAAT
No difference in renal clearance and secretory clearance of adefovir in family-based studies. PMID: 19940846.
-454
Arg → Gln
(D=43)
n=
G/G=
G/A=
A/A=
A=
158
78
1
0
0.006
160
80
0
0
0.000
118
59
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
62746904 GRCh37
62503480 NCBI36
  
CCTTTTCCTGGGGAAAGACATTCTT C → T TGTGCACAGGTCAGACCCCAGAGCT
- 
 
n=
C/C=
C/T=
T/T=
T=
158
78
1
0
0.006
160
74
6
0
0.037
118
59
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
 PDE
62746895 GRCh37
62503471 NCBI36
  
GGGGAAAGACATTCTTCTGTGCACA G → A GTCAGACCCCAGAGCTAAATCAAGT
- 
 
n=
G/G=
G/A=
A/A=
A=
158
79
0
0
0.000
160
79
1
0
0.006
118
59
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDEIA
62744899 GRCh37
62501475 NCBI36
  
GGGACCAGCATCTGGGCATTCATGC T → C GGAACTCTAACCAACACCCATCTGC
- 
 
n=
T/T=
T/C=
C/C=
C=
160
1
8
71
0.938
160
5
26
49
0.775
118
0
12
47
0.898
92
5
13
28
0.750
12
1
3
2
0.583
Set-II
Exon 9: CodingPDEI
62744751 GRCh37
62501327 NCBI36
18031470
ACCCCTCCATGCCTCTCTTCATCTA C → T GGTGCTGTTCCTGTGGCCGCCAGCG
-490
Tyr = Tyr
n=
C/C=
C/T=
T/T=
T=
160
78
2
0
0.013
160
80
0
0
0.000
118
59
0
0
0.000
92
46
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
62744597 GRCh37
62501173 NCBI36
  
TCCCAGGTAACACATGCAGGGTGGG G → A TGGTATTGAGACTCAAGCCCAGGCT
- 
 
n=
G/G=
G/A=
A/A=
A=
160
79
1
0
0.006
160
80
0
0
0.000
118
59
0
0
0.000
92
46
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 10: 3UTRPDE
62744220 GRCh37
62500796 NCBI36
2071 
CTTGTGTGGGTGGCCGGAGACCTGT A → G GGACCTTCCCTCCCTTTAGGGTTCT
+ 
 
n=
A/A=
A/G=
G/G=
G=
136
66
2
0
0.015
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.