UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:OAT2
HGNC Symbol:SLC22A7
HGNC Description:solute carrier family 22 (organic anion transporter), member 7
HGNC ID:10971
Superfamily:SLC
Chromosome:Chr.6(+): 43265737-43273276 GRCh37
Location:6p21.1
OMIM:604995
OMIM Phenotype:None
Accessions:NM_006672
Nucleotide RefSeq:NM_006672
Protein RefSeq:NP_006663
Entrez:10864
Ensembl:ENSG00000137204
Isoforms:4
Evidence:Substrate In Vitro Evidence: salicylate 43 X oocytes acetylsalicylate 43 X oocytes prostaglandine E2 43 X oocytes dicarboxylates 43 X oocytes p-aminohippurate 43 X oocytes Tissue Distribution Evidence: liver and kidney 43 Northern
Tissues:liver and kidney
Type:protein-coding
Sets:IV
PharmGKB ID:PA35848
HPRD ID:05409
Substrates:salicylate, acetylsalicylate, prostaglandine E2
Trivial Names:NLT, OAT2
Transcripts:NM_006672.3 [Chr.6(+): 43265998-43273276 GRCh37]
NM_153320.2 [Chr.6(+): 43265998-43273276 GRCh37]
XM_005248823.1 [Chr.6(+): 43265737-43272806 GRCh37]
XM_005248822.1 [Chr.6(+): 43265998-43271188 GRCh37]
ENST00000372574 [Chr.6(+): 43266097-43272218 GRCh37]
ENST00000372585 [Chr.6(+): 43266002-43273276 GRCh37]
ENST00000372589 [Chr.6(+): 43266002-43273276 GRCh37]
ENST00000436107 [Chr.6(+): 43269267-43271945 GRCh37]
ENST00000449231 [Chr.6(+): 43265999-43267519 GRCh37]
ENST00000451757 [Chr.6(+): 43265736-43267804 GRCh37]
ENST00000480882 [Chr.6(+): 43263432-43267258 GRCh37]
ENST00000487175 [Chr.6(+): 43263529-43269430 GRCh37]
ENST00000498232 [Chr.6(+): 43265999-43267926 GRCh37]
Annotation History:View Events (19)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC22A7.

Variant Data

View all PMT variants for SLC22A7 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC22A7 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC22A7 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
PromoterPDE
43265881 GRCh37
43373859 NCBI36
-117-216
ACCTCTGAATGGATGGCTTCCCCTT C → T CCCCAGGCACCAGGCAAGACAGGTA
+ 
 
n=
C/C=
C/T=
T/T=
T=
132
65
1
0
0.008
134
67
0
0
0.000
132
66
0
0
0.000
128
64
0
0
0.000
PMT-272
PromoterPDE
43265993 GRCh37
43373971 NCBI36
-5-104
GATTCTGGCTGCAGGCTCTCCAGTC C → T ATCCACTCCCACCTCCAGAGTCCAA
+ 
 
n=
C/C=
C/T=
T/T=
T=
132
66
0
0
0.000
134
67
0
0
0.000
132
66
0
0
0.000
128
63
1
0
0.008
PMT-272
Exon 1: CodingPDE
43266318 GRCh37
43374296 NCBI36
321222
AGGCCCATCTTCCCCGGGAGCCTGA T → C GGCACGCTCAGCTCCTGCCTCCGCT
+74
Asp = Asp
C=
0.053
0.000
0.000
0.000
PMT-272
Exon 1: CodingPDE
43266340 GRCh37
43374318 NCBI36
343244
TGATGGCACGCTCAGCTCCTGCCTC C → T GCTTTGCCTATCCCCAGGCTCTCCC
+82
Arg → Cys
(D=180)
T=
0.000
0.000
0.000
0.008
PMT-272
Exon 1: CodingPDE
43266397 GRCh37
43374375 NCBI36
400301
CACGTTGGGGGAAGAAAGGCAGAGC C → T GTGGGGAGCTGGAGGATGAACCTGC
+101
Arg → Cys
(D=180)
T=
0.008
0.000
0.000
0.000
PMT-272
Exon 1: CodingPDE
43266425 GRCh37
43374403 NCBI36
428329
GGGGAGCTGGAGGATGAACCTGCCA C → T AGTGCCCTGCTCTCAGGGCTGGGAG
+110
Thr → Ile
(D=89)
T=
0.023
0.000
0.000
0.000
PMT-272
 PDEA
43266568 GRCh37
43374546 NCBI36
  
CTTGGGTGGTTACTGTGTAGGCATT A → T GATGTATTACTTTACCTCTTAAAGT
+ 
 
T=
0.000
0.031
0.000
0.008
PMT-272
Exon 2: CodingPDE
43267208 GRCh37
43375186 NCBI36
573474
TCGCCGGTGTGCTGGTGGGGGCTGT G → A GCCTTTGGATATCTGTCCGACAGGT
+158
Val = Val
A=
0.007
0.000
0.000
0.000
PMT-272
 PDE
43267246 GRCh37
43375224 NCBI36
  

T → A, G
CTGTCCGACAGGTGGGGTGAGGCAC T → A GGGCCAATAAGAAACTGGCTGGGGG
CTGTCCGACAGGTGGGGTGAGGCAC T → G GGGCCAATAAGAAACTGGCTGGGGG
+ 

 
 
 
A=
G=
0.022
0.007
0.000
0.000
0.000
0.000
0.000
0.000
PMT-272
 PDE
43267301 GRCh37
43375279 NCBI36
  
TTCTCCCACTAGCTGGGGTATGAGC C → A TAGTCTACCTATGCCTTAGAACCTC
+ 
 
A=
0.051
0.000
0.000
0.000
PMT-272
Exon 4: CodingPDE
43267663 GRCh37
43375641 NCBI36
779680
CTGGAGTGGCTGGATGTGGAGCACC G → A CACCGTGGCTGGAGTCCTGAGCAGC
+227
Arg → His
(D=29)
A=
0.000
0.008
0.000
0.000
PMT-272
 PDE
43267831 GRCh37
43375809 NCBI36
  
TGAGGACTGCAGGCAGCTGGGGAGC G → A GGAGATACAGGAAGTGAAAGATGAG
+ 
 
A=
0.008
0.048
0.000
0.081
PMT-272
 PDE
43269015 GRCh37
43376993 NCBI36
  
CCAGGAGGTGAGGGTGAACGTGTGT G → A TGAGCATGCATATATGTGTGTGGTG
+ 
 
A=
0.009
0.000
0.000
0.000
PMT-272
 PDEI
43269029 GRCh37
43377007 NCBI36
  
TGAACGTGTGTGTGAGCATGCATAT A → C TGTGTGTGGTGGGGAGTGGGCTGTG
+ 
 
C=
0.093
0.484
0.592
0.444
PMT-272
 PDE
43269062 GRCh37
43377040 NCBI36
  
GGTGGGGAGTGGGCTGTGTCAAGTG C → T CTCCCTCCCAGAGCCCACCATATAT
+ 
 
T=
0.028
0.000
0.000
0.000
PMT-272
Exon 6: CodingPDE
43269336 GRCh37
43377314 NCBI36
1060961
TCCCTACCAGGCTGTGAGCAAAGTG G → A CCGCCGGGGAACGGGTGGTCCGAAG
+321
Ala → Thr
(D=58)
A=
0.000
0.000
0.000
0.008
PMT-272
Exon 6: CodingPDE
43269348 GRCh37
43377326 NCBI36
1072973
TGTGAGCAAAGTGGCCGCCGGGGAA C → T GGGTGGTCCGAAGACCTTCATACCT
+325
Arg → Trp
(D=101)
T=
0.007
0.000
0.000
0.000
PMT-272
Exon 7: CodingPDEI
43270097 GRCh37
43378075 NCBI36
13141215
ACGCAGGACGCCGCCTCACGCAAGC T → C GGGACACTGCTGGGCACGGCCCTGG
+405
Ala = Ala
C=
0.117
0.000
0.000
0.000
PMT-272
Exon 7: CodingPDE
43270151 GRCh37
43378129 NCBI36
13681269
TCGGCACTAGACTGCTAGTGTCCTC C → T GGTGAGCCCAGTCCCATAGGTTCTG
+423
Ser = Ser
T=
0.688
0.298
0.331
0.321
PMT-272
Exon 10: 3UTR
43272655 GRCh37
43380633 NCBI36
1932 
AGGAACAGTTGACTTCCCAGAATGC A → - GTGGGCTGCTGGGCACCCCTCTCAC
+ 
 
-=
0.000
0.000
0.007
0.000
PMT-272
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
Exon 10: 3UTRPDE
43273049 GRCh37
43381027 NCBI36
2326 
CTGTCCACTGTGTGGTGCTAGGACT G → A CCAATGCCAGGCCCAAGGGACAAAA
+ 
 
A=
0.011
0.000
0.000
0.000
PMT-272
Exon 10: 3UTRPDE
43273143 GRCh37
43381121 NCBI36
2420 
AGGCACCCTGCAGGGCAATGCATGT C → T ATCCCAACCCCCACACTCCCCATCC
+ 
 
T=
0.000
0.008
0.000
0.000
PMT-272
Exon 10: 3UTRPDE
43273225 GRCh37
43381203 NCBI36
2502 
GTTGAAGGCATGGGAGCCAACATTT T → C ATTGAAGAAGCCACAGAGGCTGAAA
+ 
 
C=
0.045
0.000
0.000
0.000
PMT-272
 PDE
43273277 GRCh37
43381255 NCBI36
  
TCAATAAACACAAGTTTTATGAGTA C → A CTTGAAGCTCCAGAATGTGCTGGGG
+ 
 
A=
0.000
0.008
0.000
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.