UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:OAT3
HGNC Symbol:SLC22A8
HGNC Description:solute carrier family 22 (organic anion transporter), member 8
HGNC ID:10972
Superfamily:SLC
Chromosome:Chr.11(-): 62760296-62783317 GRCh37
Location:11q11
OMIM:607581
OMIM Phenotype:None
Accessions:AF097491
Nucleotide RefSeq:NM_004254
Protein RefSeq:NP_004245
Entrez:9376
Ensembl:ENSG00000149452
Isoforms:7
Evidence:None
Tissues:kidney, brain, skeletal muscle
Type:protein-coding
Sets:II,IV
PharmGKB ID:PA389
HPRD ID:
Substrates:p-aminohippurate, AZT, cAMP, cimetidine, dehydroepiandrosterone sulfate (DHEA-S), estradiol glucuronide, estrone sulfate, glutarate, methotrexate, ochratoxin A, prostaglandin E2, prostaglandin F2alpha, salicylate, taurocholate, tetracycline, urate, valacyclovir
Trivial Names:OAT3
Transcripts:NM_004254.3 [Chr.11(-): 62760296-62783317 GRCh37]
NM_001184736.1 [Chr.11(-): 62760296-62783317 GRCh37]
NM_001184733.1 [Chr.11(-): 62760296-62783317 GRCh37]
NM_001184732.1 [Chr.11(-): 62760296-62783317 GRCh37]
XM_005274397.1 [Chr.11(-): 62760296-62783317 GRCh37]
XM_005274398.1 [Chr.11(-): 62760296-62783313 GRCh37]
XM_005274399.1 [Chr.11(-): 62760296-62783294 GRCh37]
ENST00000311438 [Chr.11(-): 62760709-62782430 GRCh37]
ENST00000336232 [Chr.11(-): 62760296-62783311 GRCh37]
ENST00000430500 [Chr.11(-): 62760709-62783311 GRCh37]
ENST00000451262 [Chr.11(-): 62760297-62762929 GRCh37]
ENST00000535878 [Chr.11(-): 62760700-62783282 GRCh37]
ENST00000539841 [Chr.11(-): 62756626-62766971 GRCh37]
ENST00000542795 [Chr.11(-): 62763564-62768467 GRCh37]
ENST00000542904 [Chr.11(-): 62763578-62768468 GRCh37]
ENST00000544707 [Chr.11(-): 62782046-62783311 GRCh37]
ENST00000545207 [Chr.11(-): 62760555-62783287 GRCh37]

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC22A8.

Variant Data

View all PMT variants for SLC22A8 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC22A8 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC22A8 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
PromoterPDE
62783551 GRCh37
62540127 NCBI36
-234-1121
CTCGCGTTGGGCGGATGTACAAAAC G → A GAGGCACGTCTCAGACTTCCCATTT
- 
 
n=
G/G=
G/A=
A/A=
A=
136
68
0
0
0.000
136
67
1
0
0.007
134
67
0
0
0.000
134
67
0
0
0.000
n/a
0.000
PMT-272
Exon 1: 5UTR
Promoter
PDE
62783273 GRCh37
62539849 NCBI36
45-843
TGAGCTGCCCTACTACAGCAGCTGC C → T GGCCCCTAGGACAGAGCAGGGACCT
- 
 
n=
C/C=
C/T=
T/T=
T=
136
68
0
0
0.000
136
67
1
0
0.007
134
67
0
0
0.000
134
67
0
0
0.000
n/a
0.000
PMT-272
Exon 2: 5UTRPDEIA
62782446 GRCh37
62539022 NCBI36
127-16
TATGCCCTGCCCACAGCTCTGGCTC G → A TCTTGCCCCAGTGCCATGACCTTCT
- 
 
n=
G/G=
G/A=
A/A=
A=
160
71
8
1
0.063
156
71
7
0
0.045
118
35
20
4
0.237
98
34
13
2
0.173
8
4
0
0
0.000
Set-II
Exon 2: CodingPDE
62782380 GRCh37
62538956 NCBI36
19351
GTGTGGGAAGCATGGGCCATTTCCA G → A TTCCTGCATGTAGCCATACTGGGCC
-17
Gln = Gln
n=
G/G=
G/A=
A/A=
A=
160
80
0
0
0.000
156
78
0
0
0.000
118
58
1
0
0.008
98
49
0
0
0.000
8
4
0
0
0.000
Set-II
Exon 2: CodingPDE
62782278 GRCh37
62538854 NCBI36
295153
CCACCCCTGTCCACCACTGTCGCCC G → A CCCCACAATGCCTCCACAGGGCCTT
-51
Pro = Pro
n=
G/G=
G/A=
A/A=
A=
160
28
40
12
0.400
156
70
8
0
0.051
118
49
10
0
0.085
98
47
1
1
0.031
8
4
0
0
0.000
Set-II
Exon 3: CodingPDEI
62768242 GRCh37
62524818 NCBI36
529387
TGAAGGAGATGGCCCAGTCTATCTT C → A ATGGCAGGTATACTGATTGGAGGGC
-129
Phe → Leu
(D=22)
n=
C/C=
C/A=
A/A=
A=
160
80
0
0
0.000
156
78
0
0
0.000
120
60
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
 PDE1 pubI
62768113 GRCh37
62524689 NCBI36
  
CCTACTCTGCTCCACCCGTGCACCC G → C CAAAGAGGCAAAGAGCTGGGGGAGG
- 
 
n=
G/G=
G/C=
C/C=
C=
160
32
38
10
0.362
156
54
23
1
0.160
120
24
33
3
0.325
100
35
14
1
0.160
12
3
2
1
0.333
Set-II
 PDE
62768095 GRCh37
62524671 NCBI36
  
TGCACCCGCAAAGAGGCAAAGAGCT G → C GGGGAGGGTGGGATGGCTCTTGCTG
- 
 
n=
G/G=
G/C=
C/C=
C=
160
56
21
3
0.169
156
78
0
0
0.000
120
60
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
 PDE
62768058 GRCh37
62524634 NCBI36
  
GATGGCTCTTGCTGTGTGGCCTTGG G → A CAAACCTCACTACCTTTCTGGACCA
- 
 
n=
G/G=
G/A=
A/A=
A=
160
80
0
0
0.000
156
78
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 4: CodingPDE1 pub
62767307 GRCh37
62523883 NCBI36
587445
CTCTCCTTCGAGCTACAGGTTTGGC C → A GCAGGCCCATCCTGACCTGCAGCTA
Reduced estrone sulfate and cimetidine uptake in transfected cells. PMID: 19940846.
-149
Arg → Ser
(D=110)
n=
C/C=
C/A=
A/A=
A=
160
80
0
0
0.000
160
79
1
0
0.006
118
58
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDEI
62767015 GRCh37
62523591 NCBI36
  
CCCTCTCAGGACCTCAGAGGCCTCA C → A TTAAATTTAAAAATGACAACAAGCA
- 
 
n=
C/C=
C/A=
A/A=
A=
160
80
0
0
0.000
160
80
0
0
0.000
118
57
2
0
0.017
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 5: CodingPDE
62766440 GRCh37
62523016 NCBI36
856714
ACGCCATCCCCCAGTGGCGTTGGCT G → T CAGTTAACTGTGTCCATTCCCTTCT
-238
Leu = Leu
n=
G/G=
G/T=
T/T=
T=
156
78
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 5: CodingPDE1 pubI
62766439 GRCh37
62523015 NCBI36
857715
CGCCATCCCCCAGTGGCGTTGGCTG C → T AGTTAACTGTGTCCATTCCCTTCTT
Reduced estrone sulfate and cimetidine uptake in transfected cells. PMID: 19940846.
-239
Gln → STOP
n=
C/C=
C/T=
T/T=
T=
156
78
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 5: CodingPDEIA
62766431 GRCh37
62523007 NCBI36
865723
CCCAGTGGCGTTGGCTGCAGTTAAC T → A GTGTCCATTCCCTTCTTCGTCTTCT
-241
Thr = Thr
n=
T/T=
T/A=
A/A=
A=
156
65
12
1
0.090
160
46
29
5
0.244
120
41
16
3
0.183
100
27
17
6
0.290
12
2
3
1
0.417
Set-II
Exon 6: CodingPDE1 pubI
62763607 GRCh37
62520183 NCBI36
921779
GCCCCCAGGTGGACACCAGAGTCCA T → G ACGCTGGTTGGTCTTGTCTGGAAAG
Reduced estrone sulfate and cimetidine uptake in transfected cells. PMID: 19940846.
-260
Ile → Arg
(D=97)
n=
T/T=
T/G=
G/G=
G=
150
75
0
0
0.000
158
79
0
0
0.000
118
58
1
0
0.008
98
49
0
0
0.000
10
5
0
0
0.000
Set-II
Exon 6: CodingPDEI
62763557 GRCh37
62520133 NCBI36
971829
GTCCTCGAAGGCCCTGAAGATACTC C → T GGCGGGTGGCTGTCTTCAATGGCAA
Altered substrate specificity in transfected cells. PMID: 19940846.
-277
Arg → Trp
(D=101)
n=
C/C=
C/T=
T/T=
T=
150
74
1
0
0.007
158
79
0
0
0.000
118
59
0
0
0.000
98
49
0
0
0.000
10
5
0
0
0.000
Set-II
Exon 6: CodingPDE
62763544 GRCh37
62520120 NCBI36
984842
CTGAAGATACTCCGGCGGGTGGCTG T → C CTTCAATGGCAAGAAGGAAGAGGGA
-281
Val → Ala
(D=64)
n=
T/T=
T/C=
C/C=
C=
150
67
7
1
0.060
158
79
0
0
0.000
118
59
0
0
0.000
98
49
0
0
0.000
10
5
0
0
0.000
Set-II
Exon 7: CodingPDE2 pubs
62763264 GRCh37
62519840 NCBI36
1055913
GCTCAAACTCAACCTGCAGAAGGAG A → T TCTCCTTGGCCAAGGCCAAGTACAC
Altered substrate specificity in transfected cells. PMID: 19940846.
-305
Ile → Phe
(D=21)
n=
A/A=
A/T=
T/T=
T=
160
80
0
0
0.000
160
80
0
0
0.000
114
53
4
0
0.035
88
43
1
0
0.011
12
6
0
0
0.000
Set-II
Exon 7: CodingPDE
62763248 GRCh37
62519824 NCBI36
1071929
CAGAAGGAGATCTCCTTGGCCAAGG C → T CAAGTACACCGCAAGTGACCTGTTC
-310
Ala → Val
(D=64)
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
160
79
1
0
0.006
114
57
0
0
0.000
88
44
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
62763141 GRCh37
62519717 NCBI36
  
CTCTCCCTGCCCACACCCTGCCAAG G → C AAGGGGTGATAGACAAGGCCTCCAG
- 
 
n=
G/G=
G/C=
C/C=
C=
160
80
0
0
0.000
160
79
1
0
0.006
114
57
0
0
0.000
88
42
2
0
0.023
12
6
0
0
0.000
Set-II
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 8: CodingPDE
62762035 GRCh37
62518611 NCBI36
13371195
GCTCCTGGCAGGAGGGGCCATCTTG G → T CTCTCACCTTTGTGCCCTTGGGTGA
-399
Ala → Ser
(D=99)
n=
G/G=
G/T=
T/T=
T=
154
77
0
0
0.000
152
76
0
0
0.000
116
58
0
0
0.000
98
48
1
0
0.010
12
6
0
0
0.000
Set-II
 PDEI
62761232 GRCh37
62517808 NCBI36
  
ACCCCACAGTCATCAGGTAGGTGCT G → A GACCTGGGGCCAGGCCCAGCCAGAG
- 
 
n=
G/G=
G/A=
A/A=
A=
142
70
1
0
0.007
158
79
0
0
0.000
118
59
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDEI
62761161 GRCh37
62517737 NCBI36
  
GTGGCATTGTCCTGTCCTCTACCCA G → A GGGAGCCATCCTTTATGAACCCCAC
- 
 
n=
G/G=
G/A=
A/A=
A=
160
67
13
0
0.081
158
55
22
2
0.165
118
31
25
3
0.263
100
36
13
1
0.150
12
4
1
1
0.250
Set-II
 PDE
62761129 GRCh37
62517705 NCBI36
  
CATCCTTTATGAACCCCACACACAG G → T CTACCAATCCCTACTCTGAACCCTC
- 
 
n=
G/G=
G/T=
T/T=
T=
160
80
0
0
0.000
158
78
1
0
0.006
118
59
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
Exon 10: CodingPDEI
62761083 GRCh37
62517659 NCBI36
14841342
CCCTCGCAGGCAAACAGGTATGGGC G → A TAAGTAACCTGTGGACCCGCGTGGG
-448
Val → Ile
(D=29)
n=
G/G=
G/A=
A/A=
A=
160
79
1
0
0.006
158
77
2
0
0.013
118
59
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
 PDEI
62760859 GRCh37
62517435 NCBI36
  
CCTCTGGCCCCATCAGTGCTCCTCC C → T TGGGGAAGCAGGTCTGGGCCCAGGG
- 
 
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
158
79
0
0
0.000
118
59
0
0
0.000
100
50
0
0
0.000
12
5
1
0
0.083
Set-II
Exon 11: CodingPDEI
62760748 GRCh37
62517324 NCBI36
17321590
AGGTGGAAAAGGCCTCCCAGAGGAT C → A CCTCTACAGCCTCACGGACCAGGCC
-530
Ile = Ile
n=
C/C=
C/A=
A/A=
A=
160
74
5
1
0.044
158
79
0
0
0.000
118
59
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 11: Coding
62760733 GRCh37
62517309 NCBI36
17471605
CTCAGCTGGAGCCCAGGCCTGGTCC G → A TGAGGCTGTAGAGGGATCCTCTGGG
+535
His = His
n=
G/G=
G/A=
A/A=
A=
134
67
0
0
0.000
132
66
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
n/a
0.000
PMT-272
Exon 11: Coding
62760732 GRCh37
62517308 NCBI36
17481606
CCTCAGCTGGAGCCCAGGCCTGGTC C → T GTGAGGCTGTAGAGGGATCCTCTGG
+536
Gly → Arg
(D=125)
n=
C/C=
C/T=
T/T=
T=
134
67
0
0
0.000
132
66
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
n/a
0.000
PMT-272
Exon 11: 3UTR
62760687 GRCh37
62517263 NCBI36
1793 
GGCTAGGATCAGTCTCTGGAGGGCA G → A GGAAAGGGGGTTCCGTTGTCCTCAG
+ 
 
n=
G/G=
G/A=
A/A=
A=
134
67
0
0
0.000
132
66
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
n/a
0.000
PMT-272
Exon 11: 3UTR
62760604 GRCh37
62517180 NCBI36
1876 
GAGACACCTTCACCAAGCTCTCAGA A → C GGCTTCATCCTAGGAGGATGGACCT
+ 
 
n=
A/A=
A/C=
C/C=
C=
134
66
1
0
0.007
132
66
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272
Exon 11: 3UTR
62760512 GRCh37
62517088 NCBI36
1968 
GGCAGGGCCTGGGTTGCAGGGAGAA C → A AAGGGCAGGGATGGCTGAACCTTTG
+ 
 
n=
C/C=
C/A=
A/A=
A=
134
67
0
0
0.000
132
66
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
n/a
0.000
PMT-272
 
62760292 GRCh37
62516868 NCBI36
  
ATCCCACCCCCATTCCTGAACATCA T → C GGCTAGAGTTCTTATCGCTGTTTAT
+ 
 
n=
T/T=
T/C=
C/C=
C=
134
65
2
0
0.015
132
66
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272
 
62760205 GRCh37
62516781 NCBI36
  
CTGTGGTGCCTGTACACAGGCCTGT C → T GTACATGAAGTGTGGATGGACAGAT
+ 
 
n=
C/C=
C/T=
T/T=
T=
134
63
4
0
0.030
132
66
0
0
0.000
136
65
3
0
0.022
136
68
0
0
0.000
n/a
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.