UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:OAT4
HGNC Symbol:SLC22A9
HGNC Description:solute carrier family 22 (organic anion transporter), member 9
HGNC ID:16261
Superfamily:SLC
Chromosome:Chr.11(+): 63137142-63177731 GRCh37
Location:11q13.1
OMIM:607579
OMIM Phenotype:None
Accessions:AF440402,AK074246
Nucleotide RefSeq:NM_080866
Protein RefSeq:NP_543142
Entrez:114571
Ensembl:ENSG00000149742
Isoforms:2
Evidence:Tissue Distribution Evidence: Liver - Review article. Koepsell H, Endou H. Pflugers Archives. 2003 (Epub).
Tissues:Liver
Type:protein-coding
Sets:0
PharmGKB ID:PA38102
HPRD ID:06982
Substrates:No data
Trivial Names:OAT4, OAT7, ust3, HOAT4, UST3H
Transcripts:NM_080866.2 [Chr.11(+): 63137261-63177731 GRCh37]
XM_005273736.1 [Chr.11(+): 63137142-63177573 GRCh37]
ENST00000279178 [Chr.11(+): 63137280-63177766 GRCh37]
ENST00000310969 [Chr.11(+): 63137261-63177710 GRCh37]
ENST00000536333 [Chr.11(+): 63137261-63177430 GRCh37]
Annotation History:View Events (10)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC22A9.

Variant Data

View all PMT variants for SLC22A9 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC22A9 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC22A9 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
63136923 GRCh37
62893499 NCBI36
-338-606
ATTCTGTCCACATTTCAAGCAATGT A → G TTTCCAGCATGAATTTGTGGTGTGA
+ 
 
n=
A/A=
A/G=
G/G=
G=
136
68
0
0
0.000
136
68
0
0
0.000
132
64
2
0
0.015
118
59
0
0
0.000
PMT-272
PromoterPDE
63137122 GRCh37
62893698 NCBI36
-139-407
AAGTAAAAAAAGCACCTCACCTTTG A → G GTCGCCAAAATTATGCTTCCTGGAA
+ 
 
n=
A/A=
A/G=
G/G=
G=
136
68
0
0
0.000
136
68
0
0
0.000
132
66
0
0
0.000
118
58
1
0
0.008
PMT-272
PromoterPDE
63137138 GRCh37
62893714 NCBI36
-123-391
TCACCTTTGAGTCGCCAAAATTATG C → T TTCCTGGAATGACCGCATACCATGT
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
68
0
0
0.000
136
68
0
0
0.000
132
65
1
0
0.008
118
59
0
0
0.000
PMT-272
PromoterPDE
63137221 GRCh37
62893797 NCBI36
-40-308
TGTAGACCAAAGTCCAGTGCTGACT T → G TGGGAGCTACTAAAGACATGAAAAA
+ 
 
n=
T/T=
T/G=
G/G=
G=
130
64
1
0
0.008
134
59
8
0
0.060
132
66
0
0
0.000
132
63
2
1
0.030
PMT-272
Exon 1: 5UTRPDE
63137329 GRCh37
62893905 NCBI36
69-200
CTTACGTGACTTTAGAGAAAACGGC TA → - CCTATCTGACCCCAAAACGACTTG
+ 
 
n=
TA/TA=
TA/-=
-/-=
-=
130
64
1
0
0.008
134
66
1
0
0.007
132
66
0
0
0.000
132
65
1
0
0.008
PMT-272
Exon 1: 5UTRPDEI
63137384 GRCh37
62893960 NCBI36
124-145
AACTGTTTCCACGGTCCTGCTGCAG A → G GGGGAAGCACAGTCGTCAAGAAGAG
+ 
 
n=
A/A=
A/G=
G/G=
G=
128
34
25
5
0.273
132
6
31
29
0.674
132
21
34
11
0.424
130
18
27
20
0.515
PMT-272
Exon 1: 5UTRPDE
63137406 GRCh37
62893982 NCBI36
146-123
CAGAGGGGAAGCACAGTCGTCAAGA A → G GAGAGTGGGGTCAGGATCAAAACAC
+ 
 
n=
A/A=
A/G=
G/G=
G=
128
64
0
0
0.000
132
64
2
0
0.015
132
66
0
0
0.000
130
64
1
0
0.008
PMT-272
Exon 1: 5UTRPDE
63137497 GRCh37
62894073 NCBI36
237-32
GAACCTCTCTGGATACAGTCATTTT G → T CCTCTACTTGAGGATCAACTGTTCA
+ 
 
n=
G/G=
G/T=
T/T=
T=
128
64
0
0
0.000
132
65
1
0
0.008
132
66
0
0
0.000
130
65
0
0
0.000
PMT-272
Exon 1: CodingPDE
63137714 GRCh37
62894290 NCBI36
454186
TGGACAATGACACTGTCTCTGACAA T → C GACACTGGGGCCCTCAGCCAAGATG
+62
Asn = Asn
n=
T/T=
T/C=
C/C=
C=
128
64
0
0
0.000
132
65
1
0
0.008
132
66
0
0
0.000
130
65
0
0
0.000
PMT-272
Exon 1: CodingPDE
63137793 GRCh37
62894369 NCBI36
533265
CTCAAACATGAGGCCAGAGAAGTGT C → T GTCGCTTTGTTCATCCTCAGTGGCA
+89
Arg → Cys
(D=180)
n=
C/C=
C/T=
T/T=
T=
128
64
0
0
0.000
132
65
1
0
0.008
132
66
0
0
0.000
130
65
0
0
0.000
PMT-272
 PDE
63138451 GRCh37
62895027 NCBI36
  
CAAGAGAAAGTTATGTTTAAGTTGA G → C ACCTGAATAACAAAGGTCAGGTAAT
+ 
 
n=
G/G=
G/C=
C/C=
C=
128
63
1
0
0.008
134
67
0
0
0.000
136
68
0
0
0.000
128
64
0
0
0.000
PMT-272
 PDEIA
63138482 GRCh37
62895058 NCBI36
  
AATAACAAAGGTCAGGTAATGCTGA G → A AAAGGAAGCCACAGAGGAAGTTAGA
+ 
 
n=
G/G=
G/A=
A/A=
A=
128
5
28
31
0.703
134
10
27
30
0.649
136
22
35
11
0.419
128
17
24
23
0.547
PMT-272
 PDE
63138762 GRCh37
62895338 NCBI36
  
TTTAAGGGCATTTTTTATCAACTTA T → C GAAACATTATTTCATCTAGAATTAC
+ 
 
n=
T/T=
T/C=
C/C=
C=
128
61
3
0
0.023
134
67
0
0
0.000
136
68
0
0
0.000
128
64
0
0
0.000
PMT-272
 PDEA
63138853 GRCh37
62895429 NCBI36
  
AAACAGAAAAGGAAATTTTTAGTCC G → A TGTTTTGAGTGCTATTTTTAAAATT
+ 
 
n=
G/G=
G/A=
A/A=
A=
128
64
0
0
0.000
134
67
0
0
0.000
136
63
5
0
0.037
128
56
7
1
0.070
PMT-272
Exon 3: CodingPDE
63141132 GRCh37
62897708 NCBI36
791523
GTTTCTCAGGTTTGGGAGAAGGTTC G → C TGCTCAGATGGTGTTACCTCCAGGT
+175
Val → Leu
(D=32)
n=
G/G=
G/C=
C/C=
C=
126
62
1
0
0.008
130
65
0
0
0.000
134
67
0
0
0.000
130
65
0
0
0.000
PMT-272
Exon 3: CodingPDE
63141138 GRCh37
62897714 NCBI36
797529
CAGGTTTGGGAGAAGGTTCGTGCTC A → T GATGGTGTTACCTCCAGGTTGCCAT
+177
Arg → STOP
n=
A/A=
A/T=
T/T=
T=
126
63
0
0
0.000
130
65
0
0
0.000
134
66
1
0
0.007
130
65
0
0
0.000
PMT-272
Exon 3: CodingPDEI
63141254 GRCh37
62897830 NCBI36
913645
GGATTGCTGCAATGAGCCTCATAAC A → G AATACTATTATGTTAAGTAAGCCAA
+215
Thr = Thr
n=
A/A=
A/G=
G/G=
G=
126
63
0
0
0.000
130
64
1
0
0.008
134
67
0
0
0.000
130
64
1
0
0.008
PMT-272
Exon 4: CodingPDE
63141410 GRCh37
62897986 NCBI36
974706
CAGATTCCAGGCCATGGGAATTACA T → C TGGGAATGTGCCCTTCTGGTATTGC
+236
Leu = Leu
n=
T/T=
T/C=
C/C=
C=
126
63
0
0
0.000
130
65
0
0
0.000
134
67
0
0
0.000
130
64
1
0
0.008
PMT-272
Exon 4: CodingPDE
63141443 GRCh37
62898019 NCBI36
1007739
GTGCCCTTCTGGTATTGCATTTATG A → T CCCTGGCAGGCCTGGCTTTTGCCAT
+247
Thr → Ser
(D=58)
n=
A/A=
A/T=
T/T=
T=
126
62
1
0
0.008
130
65
0
0
0.000
134
67
0
0
0.000
130
65
0
0
0.000
PMT-272
 PDE
63141622 GRCh37
62898198 NCBI36
  
GGACACCTGAATTTCTTTTTGTTCT T → C TGTGTAAACCTGAGAGCACGTCCTC
+ 
 
n=
T/T=
T/C=
C/C=
C=
126
63
0
0
0.000
130
64
1
0
0.008
134
67
0
0
0.000
130
65
0
0
0.000
PMT-272
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
63141626 GRCh37
62898202 NCBI36
  
ACCTGAATTTCTTTTTGTTCTTTGT G → A TAAACCTGAGAGCACGTCCTCTCAT
+ 
 
n=
G/G=
G/A=
A/A=
A=
126
62
1
0
0.008
130
65
0
0
0.000
134
67
0
0
0.000
130
65
0
0
0.000
PMT-272
 PDE
63143298 GRCh37
62899874 NCBI36
  
GGGAAGACATAACTTGTCATCAATA C → T TTAGCAGTAGCAGTGTCCATAAGGT
+ 
 
n=
C/C=
C/T=
T/T=
T=
128
64
0
0
0.000
128
63
1
0
0.008
136
68
0
0
0.000
128
64
0
0
0.000
PMT-272
 PDE
63143354 GRCh37
62899930 NCBI36
  
AAGGAAAGAAACACAGGTATGGTTA T → C GGGCTGTATCACCTCACTATCATTT
+ 
 
n=
T/T=
T/C=
C/C=
C=
128
58
6
0
0.047
128
64
0
0
0.000
136
68
0
0
0.000
128
63
0
1
0.016
PMT-272
 PDE
63149868 GRCh37
62906444 NCBI36
  
TTTGCACATAAAAGATGAGAAAGCC G → C TAAAGAGAATTGCTGTGTTTGAATG
+ 
 
n=
G/G=
G/C=
C/C=
C=
132
65
1
0
0.008
134
67
0
0
0.000
132
66
0
0
0.000
134
67
0
0
0.000
PMT-272
 PDEI
63173684 GRCh37
62930260 NCBI36
  
ATACCTTTGAAAAGTCTTCAGAAAT T → G ATCCTGCTTCATAAGACACAGTCTG
+ 
 
n=
T/T=
T/G=
G/G=
G=
124
38
19
5
0.234
128
40
21
3
0.211
124
4
25
33
0.734
128
36
26
2
0.234
PMT-272
 PDE
63173715 GRCh37
62930291 NCBI36
  
GCTTCATAAGACACAGTCTGTATCT C → G TTTCTGAACATATTTAAGCATCTAA
+ 
 
n=
C/C=
C/G=
G/G=
G=
124
50
11
1
0.105
128
64
0
0
0.000
124
62
0
0
0.000
128
64
0
0
0.000
PMT-272
 PDE
63173751 GRCh37
62930327 NCBI36
  
TATTTAAGCATCTAACTTCCAGCCT C → T TTCTCTAGTATTAATAACTTCTTCA
+ 
 
n=
C/C=
C/T=
T/T=
T=
124
23
26
13
0.419
128
32
30
2
0.266
124
3
24
35
0.758
128
21
33
10
0.414
PMT-272
 PDE
63173767 GRCh37
62930343 NCBI36
  

A → C, G
TTCCAGCCTCTTCTCTAGTATTAAT A → C ACTTCTTCACAAATAGTTCCATAAT
TTCCAGCCTCTTCTCTAGTATTAAT A → G ACTTCTTCACAAATAGTTCCATAAT
+ 

 
 
 
n=
A/A=
A/C=
C/C=
A/G=
G/G=
C/G=
C=
G=
124
61
1
0
0
0
0
0.008
0.000
128
64
0
0
0
0
0
0.000
0.000
124
62
0
0
0
0
0
0.000
0.000
128
63
0
0
1
0
0
0.000
0.008
PMT-272
 PDE
63173808 GRCh37
62930384 NCBI36
  
GTTCCATAATGTTATCATTATCACT T → A AATAGATTTCTTTAAATCACGTTGC
+ 
 
n=
T/T=
T/A=
A/A=
A=
124
37
19
6
0.250
128
40
21
3
0.211
124
7
24
31
0.694
128
37
26
1
0.219
PMT-272
 PDE
63173841 GRCh37
62930417 NCBI36
  
TTCTTTAAATCACGTTGCAAGAAAA T → C ATTCCATGAAATAGACCCAGCCTTT
+ 
 
n=
T/T=
T/C=
C/C=
C=
124
54
8
0
0.065
128
64
0
0
0.000
124
62
0
0
0.000
128
64
0
0
0.000
PMT-272
Exon 7: CodingPDE
63174050 GRCh37
62930626 NCBI36
14231155
ACAATGTTTTCCTGTTGCAGACTCT C → T TTTGGTGCAGTCATCCTCCTGGCCA
+385
Leu = Leu
n=
C/C=
C/T=
T/T=
T=
124
52
8
2
0.097
128
64
0
0
0.000
124
62
0
0
0.000
128
64
0
0
0.000
PMT-272
Exon 7: CodingPDE
63174102 GRCh37
62930678 NCBI36
14751207
CTGTGTTGCACCTTGGGCACTGAAA T → C ACATGAACCGTCGAGCAAGCCAGAT
+403
Tyr → His
(D=83)
n=
T/T=
T/C=
C/C=
C=
124
60
2
0
0.016
128
64
0
0
0.000
124
61
1
0
0.008
128
63
1
0
0.008
PMT-272
Exon 7: CodingPDE
63174113 GRCh37
62930689 NCBI36
14861218
CTTGGGCACTGAAATACATGAACCG T → A CGAGCAAGCCAGATGCTTCTCATGT
+406
Arg = Arg
n=
T/T=
T/A=
A/A=
A=
124
62
0
0
0.000
128
64
0
0
0.000
124
61
1
0
0.008
128
64
0
0
0.000
PMT-272
 PDE
63175395 GRCh37
62931971 NCBI36
  
CAGATCCTTTTTATGCATTATTTAA G → A CCACAAGGCGAAGACAAATCATGTT
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
63
3
0
0.023
130
65
0
0
0.000
134
67
0
0
0.000
134
67
0
0
0.000
PMT-272
 PDE
63175442 GRCh37
62932018 NCBI36
  
TGTTTCTCAGCTATCAGCCACTGCA C → T ATTCTTTGCCTCTATGCAGTTTCCC
+ 
 
n=
C/C=
C/T=
T/T=
T=
132
55
11
0
0.083
130
65
0
0
0.000
134
67
0
0
0.000
134
67
0
0
0.000
PMT-272
 PDE
63175503 GRCh37
62932079 NCBI36
  
TTAACCCTTGCAAACACCTCCAATA C → T AGTCCTTTTCACTTCTACCTTGGGG
+ 
 
n=
C/C=
C/T=
T/T=
T=
132
66
0
0
0.000
130
64
1
0
0.008
134
67
0
0
0.000
134
67
0
0
0.000
PMT-272
 PDE
63175576 GRCh37
62932152 NCBI36
  
TTTCCTGAGGCCTTGTGTTCTTCCT T → G TCTCCAGAAATGCAGACGCTGCGTG
+ 
 
n=
T/T=
T/G=
G/G=
G=
132
65
1
0
0.008
130
65
0
0
0.000
134
67
0
0
0.000
134
67
0
0
0.000
PMT-272
Exon 8: CodingPDE
63175593 GRCh37
62932169 NCBI36
15661298
TTCTTCCTTTCTCCAGAAATGCAGA C → T GCTGCGTGAGGTTTTGGCAACACTG
+433
Thr → Met
(D=81)
n=
C/C=
C/T=
T/T=
T=
132
65
1
0
0.008
130
58
7
0
0.054
134
67
0
0
0.000
134
64
2
1
0.030
PMT-272
Exon 8: CodingPDE
63175642 GRCh37
62932218 NCBI36
16151347
TGGGCTTAGGAGCGTCTGCTCTTGC C → T AATACCCTTGCTTTTGCCCATGGAA
+449
Ala = Ala
n=
C/C=
C/T=
T/T=
T=
132
65
1
0
0.008
130
65
0
0
0.000
134
67
0
0
0.000
134
67
0
0
0.000
PMT-272
Exon 8: CodingPDE
63175679 GRCh37
62932255 NCBI36
16521384
TTTTGCCCATGGAAATGAAGTAATT C → A CCACCATAATCAGGTACAGAACCTT
+462
Pro → Thr
(D=38)
n=
C/C=
C/A=
A/A=
A=
132
65
1
0
0.008
130
65
0
0
0.000
134
67
0
0
0.000
134
67
0
0
0.000
PMT-272
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
Exon 9: CodingPDE
63176199 GRCh37
62932775 NCBI36
17171449
CCTTTGCTAATATAGCAGGAGCCCT G → T GCTCCCCTCATGATGATCCTAAGTG
+483
Leu = Leu
n=
G/G=
G/T=
T/T=
T=
130
65
0
0
0.000
132
66
0
0
0.000
136
68
0
0
0.000
134
66
1
0
0.007
PMT-272
Exon 9: CodingPDE
63176217 GRCh37
62932793 NCBI36
17351467
GAGCCCTGGCTCCCCTCATGATGAT C → T CTAAGTGTGTATTCTCCACCCCTGC
+489
Ile = Ile
n=
C/C=
C/T=
T/T=
T=
130
65
0
0
0.000
132
66
0
0
0.000
136
67
1
0
0.007
134
67
0
0
0.000
PMT-272
 PDEI
63176367 GRCh37
62932943 NCBI36
  
AGAAAAATGAGTGAGTAAATAGCCC G → A GTTGCCCCTCAGAGGATCTGTGTGC
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
15
30
20
0.538
132
33
30
3
0.273
136
2
21
45
0.816
134
22
35
10
0.410
PMT-272
 PDE
63176394 GRCh37
62932970 NCBI36
  
TTGCCCCTCAGAGGATCTGTGTGCT A → G TAGGTCTGTGCTGAGGAAGGCAAAA
+ 
 
n=
A/A=
A/G=
G/G=
G=
130
62
3
0
0.023
132
66
0
0
0.000
136
68
0
0
0.000
134
66
1
0
0.007
PMT-272
 PDE
63176450 GRCh37
62933026 NCBI36
  
TTTAGGGCCACTGTCCTCTCAAAAG G → A CTTAGACTTAGGATTTTCCCATGTA
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
64
1
0
0.008
132
66
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
 PDE
63176482 GRCh37
62933058 NCBI36
  
CTTAGGATTTTCCCATGTAATCAGT G → A CCTTAGGTCTAGGTACAGCCACATG
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
63
2
0
0.015
132
66
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
 PDE
63176494 GRCh37
62933070 NCBI36
  
CCATGTAATCAGTGCCTTAGGTCTA G → C GTACAGCCACATGCCTTCCCACAGT
+ 
 
n=
G/G=
G/C=
C/C=
C=
130
64
1
0
0.008
132
65
1
0
0.008
136
63
5
0
0.037
134
49
17
1
0.142
PMT-272
 PDE
63176514 GRCh37
62933090 NCBI36
  
GTCTAGGTACAGCCACATGCCTTCC C → T ACAGTGACCTCAGACACCCTCTGAG
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
62
3
0
0.023
132
66
0
0
0.000
136
68
0
0
0.000
134
66
1
0
0.007
PMT-272
 PDE
63176534 GRCh37
62933110 NCBI36
  
CTTCCCACAGTGACCTCAGACACCC T → C CTGAGGCTCTCCAGATCACACAGAC
+ 
 
n=
T/T=
T/C=
C/C=
C=
130
2
19
44
0.823
132
31
29
6
0.311
136
2
21
45
0.816
134
19
36
12
0.448
PMT-272
 PDE
63176548 GRCh37
62933124 NCBI36
  
CTCAGACACCCTCTGAGGCTCTCCA G → C ATCACACAGACCAGCTCTGCCCAGC
+ 
 
n=
G/G=
G/C=
C/C=
C=
130
63
2
0
0.015
132
66
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
 PDE
63177203 GRCh37
62933779 NCBI36
  
AGAATCAACATTCCTTAAAGAATGC G → A GGACTTACATGTTTAGTCCATGTCT
+ 
 
n=
G/G=
G/A=
A/A=
A=
128
50
14
0
0.109
130
62
3
0
0.023
134
67
0
0
0.000
136
64
4
0
0.029
PMT-272
 PDE
63177248 GRCh37
62933824 NCBI36
  
ATGTCTTTTCATTTTTGTGATTTTT T → TT GTTGGTTTCTTTGTATTTGTTCTAG
+ 
 
n=
T/T=
T/TT=
TT/TT=
TT=
128
15
30
19
0.531
130
32
30
3
0.277
134
2
20
45
0.821
136
22
35
11
0.419
PMT-272
Exon 10: 3UTRPDE
63177436 GRCh37
62934012 NCBI36
2032 
ATCTAGAAAATAAATAACAAGGCTG G → A GTGCGGTGGCTCACGCCTGTAATCC
+ 
 
n=
G/G=
G/A=
A/A=
A=
128
63
1
0
0.008
130
65
0
0
0.000
134
67
0
0
0.000
136
67
1
0
0.007
PMT-272
Exon 10: 3UTRPDE
63177439 GRCh37
62934015 NCBI36
2035 
TAGAAAATAAATAACAAGGCTGGGT G → A CGGTGGCTCACGCCTGTAATCCCAG
+ 
 
n=
G/G=
G/A=
A/A=
A=
128
45
18
1
0.156
130
65
0
0
0.000
134
67
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 10: 3UTRPDE
63177450 GRCh37
62934026 NCBI36
2046 
TAACAAGGCTGGGTGCGGTGGCTCA C → T GCCTGTAATCCCAGCACCTTGGGAG
+ 
 
n=
C/C=
C/T=
T/T=
T=
128
62
2
0
0.016
130
65
0
0
0.000
134
67
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 10: 3UTRPDE
63177528 GRCh37
62934104 NCBI36
2124 
AAGATAAAGACCACCCTGGCCAACA T → C GGTGAAACCCTGTCTCTACTAAAAC
+ 
 
n=
T/T=
T/C=
C/C=
C=
128
64
0
0
0.000
132
63
3
0
0.023
136
68
0
0
0.000
134
64
3
0
0.022
PMT-272
Exon 10: 3UTR
63177643 GRCh37
62934219 NCBI36
2239 

G → A, T
GCAGGAGAATTACTTGAACCCAGGA G → A GTGGAAATTGCAATGAGCCAAGATT
GCAGGAGAATTACTTGAACCCAGGA G → T GTGGAAATTGCAATGAGCCAAGATT
+ 

 
 
 
n=
G/G=
G/A=
A/A=
G/T=
T/T=
A/T=
A=
T=
128
52
0
0
12
0
0
0.000
0.094
132
66
0
0
0
0
0
0.000
0.000
136
68
0
0
0
0
0
0.000
0.000
134
66
1
0
0
0
0
0.007
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.