UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:SPNT1
HGNC Symbol:SLC28A2
HGNC Description:solute carrier family 28 (concentrative nucleoside transporter), member 2
HGNC ID:11002
Superfamily:SLC
Chromosome:Chr.15(+): 45544428-45568132 GRCh37
Location:15q15
OMIM:606208
OMIM Phenotype:None
Accessions:U84392
Nucleotide RefSeq:NM_004212
Protein RefSeq:NP_004203
Entrez:9153
Ensembl:ENSG00000137860
Isoforms:1
Evidence:None
Tissues:Kidney, liver, heart, brain, placenta, pancreas, skeletal muscle, colon, rectum, duodenum, jejunum, ileum
Type:protein-coding
Sets:I,IV
PharmGKB ID:PA386
HPRD ID:07069
Substrates:ddI, Ribavirin, Purine nucleosides and uridine
Trivial Names:CNT2, HCNT2, SPNT1, HsT17153
Transcripts:NM_004212.3 [Chr.15(+): 45544428-45568132 GRCh37]
ENST00000347644 [Chr.15(+): 45544428-45568133 GRCh37]
ENST00000559924 [Chr.15(+): 45555259-45559950 GRCh37]
ENST00000560438 [Chr.15(+): 45544432-45556881 GRCh37]
ENST00000560767 [Chr.15(+): 45563972-45568149 GRCh37]
Annotation History:View Events (2)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC28A2.

Variant Data

View all PMT variants for SLC28A2 on UCSC Genome Browser
Showing SNP features for transcript: NM_004212  
SLC28A2 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC28A2 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 PDE
45543528 GRCh37
43330820 NCBI36
-900-1886
TGTTGGCCAGGGTGGTCTCGAGCGC C → T TGACCTCAAATGATCCGCCTGCCTC
+ 
 
n=
C/C=
C/T=
T/T=
T=
200
17
74
9
0.460
200
11
33
56
0.725
60
18
8
4
0.267
20
3
6
1
0.400
14
2
4
1
0.429
Set-I
 PDE
45543554 GRCh37
43330846 NCBI36
-874-1860
TGACCTCAAATGATCCGCCTGCCTC T → C GCCTCCCAGTGTGCTGGGATTACAA
+ 
 
n=
T/T=
T/C=
C/C=
C=
200
0
45
55
0.775
200
0
2
98
0.990
60
3
4
23
0.833
20
0
1
9
0.950
14
0
1
6
0.929
Set-I
 PDEI
45543870 GRCh37
43331162 NCBI36
-558-1544
TGGTAAATTTTCTGGGTGCAGAGAC G → A GCTCTTACTGTATTTTACAGGCTAC
+ 
 
n=
G/G=
G/A=
A/A=
A=
200
11
63
26
0.575
200
11
33
56
0.725
60
18
8
4
0.267
20
3
6
1
0.400
14
3
3
1
0.357
Set-I
 PDEI
45544112 GRCh37
43331404 NCBI36
-316-1302
GCCGAGTAACTGGAACCACAGTCGT G → A TGCCACCGCGCCCAGCTAATTTTTG
+ 
 
n=
G/G=
G/A=
A/A=
A=
200
74
24
2
0.140
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
45544170 GRCh37
43331462 NCBI36
-258-1244
TGTAGAGATGTGGTTTCGCCATGTT A → G TCCTGGCTGGTCTCAAGCGATCCGC
+ 
 
n=
A/A=
A/G=
G/G=
G=
200
10
63
27
0.585
200
11
33
56
0.725
60
18
8
4
0.267
20
3
6
1
0.400
14
2
4
1
0.429
Set-I
PromoterPDE1 pub
45544193 GRCh37
43331485 NCBI36
-235-1221
TTATCCTGGCTGGTCTCAAGCGATC C → T GCCCGTCTCGGCCTCCCGAAGTGCT
+ 
 
n=
C/C=
C/T=
T/T=
T=
200
99
1
0
0.005
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
PromoterPDE1 pubI
45544288 GRCh37
43331580 NCBI36
-140-1126
AAAACAGTCTTAAAAACATATAATA T → A TTAACTTGAGAGGTGCAGTCCTCCT
-146A allele showed increased luciferase activity in reporter assays in cells and in vivo assay. PMID: 19940846.
+ 
 
n=
T/T=
T/A=
A/A=
A=
200
8
64
28
0.600
200
11
33
56
0.725
60
18
8
4
0.267
20
3
6
1
0.400
14
1
5
1
0.500
Set-I
PromoterPDE1 pubI
45544319 GRCh37
43331611 NCBI36
-109-1095
TTGAGAGGTGCAGTCCTCCTCTACA T → G TGAGGGCAGGCTCAGCGAAGGAGGG
+ 
 
n=
T/T=
T/G=
G/G=
G=
200
0
6
94
0.970
200
0
2
98
0.990
60
3
5
22
0.817
20
0
0
10
1.000
14
0
1
6
0.929
Set-I
PromoterPDE1 pub
45544420 GRCh37
43331712 NCBI36
-8-994
AGCTGCCCCTCCTCCCTCGCAGCTG A → T GCTTTTCTTTCAGTCCTTCACTGAG
+ 
 
n=
A/A=
A/T=
T/T=
T=
200
96
4
0
0.020
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Promoter
Exon 1: 5UTR
PDE1 pub
45544433 GRCh37
43331725 NCBI36
6-981
CCCTCGCAGCTGAGCTTTTCTTTCA G → A TCCTTCACTGAGGAGCCAGAGGGAA
+ 
 
n=
G/G=
G/A=
A/A=
A=
200
99
1
0
0.005
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
45545381 GRCh37
43332673 NCBI36
 -33
AATGACCAATCTTTCAGGCTTGGCC C → - TGAATTTGTTTTTCAGTTGAGGAGA
+ 
 
n=
C/C=
C/-=
-/-=
-=
198
52
39
8
0.278
196
8
52
38
0.653
58
10
10
9
0.483
20
3
7
0
0.350
14
6
1
0
0.071
Set-I
Exon 2: CodingPDE4 pubs
45545478 GRCh37
43332770 NCBI36
13065
ACAGTGGAGACTGGCACAGTGAACC C → T GGGGCTGGAGCTCATGGTAATCACC
+22
Pro → Leu
(D=98)
n=
C/C=
C/T=
T/T=
T=
198
66
30
3
0.182
194
10
52
35
0.629
58
10
12
7
0.448
20
3
7
0
0.350
14
5
2
0
0.143
Set-I
Exon 4: CodingPDE5 pubsI
45554267 GRCh37
43341559 NCBI36
290225
GAAGTTTCTGCAAAACACACGCCAG C → A TTGTTCAAGAAGATCCTGTTGGGCC
+75
Ser → Arg
(D=110)
n=
C/C=
C/A=
A/A=
A=
198
71
25
3
0.157
200
7
52
41
0.670
60
20
9
1
0.183
20
3
7
0
0.350
14
6
1
0
0.071
Set-I
 PDE
45554329 GRCh37
43341621 NCBI36
  
GGTGAGATATTGAGAATTCATGAAA G → A TGAGAAACACAGTTATTTTAGAAAT
+ 
 
n=
G/G=
G/A=
A/A=
A=
198
98
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 6: CodingPDE2 pubsI
45556120 GRCh37
43343412 NCBI36
553488
TCCTTGGTTGGCCTTATACTGTGGT T → G GGCTTTAGACACAGCCCAAAGGCCA
+163
Leu → Trp
(D=61)
n=
T/T=
T/G=
G/G=
G=
200
100
0
0
0.000
200
100
0
0
0.000
60
28
2
0
0.033
20
8
2
0
0.100
14
7
0
0
0.000
Set-I
Exon 6: CodingPDE2 pubs
45556163 GRCh37
43343455 NCBI36
596531
AAAGGCCAGAGCAGCTGATCCCCTT T → C GCAGGAATCTGCATGTTCATCCTTA
+177
Phe = Phe
n=
T/T=
T/C=
C/C=
C=
200
25
56
19
0.470
200
100
0
0
0.000
60
30
0
0
0.000
20
8
2
0
0.100
14
3
1
3
0.500
Set-I
 PDEIA
45556829 GRCh37
43344121 NCBI36
  
TAATGGACTAGCAGAACTCACATTG A → G AATAATATTCTTATTGATCCTAGGT
+ 
 
n=
A/A=
A/G=
G/G=
G=
176
8
46
34
0.648
182
7
45
39
0.676
52
18
7
1
0.173
14
1
5
1
0.500
14
2
2
3
0.571
Set-I
 PDE
45556984 GRCh37
43344276 NCBI36
  
AGGTCCAGGTATGAGAAATTAAATG C → T GAGGGCTTTTCTCTTTTAGAACCCT
+ 
 
n=
C/C=
C/T=
T/T=
T=
198
98
1
0
0.005
194
97
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
45557052 GRCh37
43344344 NCBI36
  
GAGGAGCATGAGAAGATTAGGCTGT A → T TCTTGTTAATGATGTGGTGGAAGAT
+ 
 
n=
A/A=
A/T=
T/T=
T=
198
98
1
0
0.005
194
97
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
45557119 GRCh37
43344411 NCBI36
  
AGAGTGTACTAGGATACAGCTAAGA A → G TATGAATAAAGAGCTCATGGGGACA
+ 
 
n=
A/A=
A/G=
G/G=
G=
198
99
0
0
0.000
194
97
0
0
0.000
60
28
2
0
0.033
20
10
0
0
0.000
14
6
1
0
0.071
Set-I
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 PDE
45557152 GRCh37
43344444 NCBI36
  
AAAGAGCTCATGGGGACATAGCCTG C → G CCCTGGGCTGTCAAAGGGAGGCCAA
+ 
 
n=
C/C=
C/G=
G/G=
G=
198
23
58
18
0.475
194
97
0
0
0.000
60
30
0
0
0.000
20
8
2
0
0.100
14
3
1
3
0.500
Set-I
 PDE
45557206 GRCh37
43344498 NCBI36
  
CAGTAGCAACAGTAGGTCCTCAGGA C → T GCATGGGGCTGGTCTCGTCTTCCTG
+ 
 
n=
C/C=
C/T=
T/T=
T=
198
98
1
0
0.005
194
97
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 8: CodingPDE1 pubA
45557318 GRCh37
43344610 NCBI36
799734
CTGAACTACACTGTGGCCGGCTCCA G → C TTTTGTCTTTGGGGATACACTGGTC
+245
Ser → Thr
(D=58)
n=
G/G=
G/C=
C/C=
C=
198
58
37
4
0.227
194
97
0
0
0.000
60
29
1
0
0.017
20
8
2
0
0.100
14
6
1
0
0.071
Set-I
 PDE
45559642 GRCh37
43346934 NCBI36
  
CTTCTTGGAATCTGACTGTTTTCTC C → T GTGTTTGTAGACAGAGGCACCTCTG
+ 
 
n=
C/C=
C/T=
T/T=
T=
200
99
1
0
0.005
198
99
0
0
0.000
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
45559643 GRCh37
43346935 NCBI36
  
TTCTTGGAATCTGACTGTTTTCTCC G → A TGTTTGTAGACAGAGGCACCTCTGC
+ 
 
n=
G/G=
G/A=
A/A=
A=
200
100
0
0
0.000
198
99
0
0
0.000
58
29
0
0
0.000
20
10
0
0
0.000
14
6
1
0
0.071
Set-I
Exon 11: CodingPDE1 pub
45559703 GRCh37
43346995 NCBI36
1058993
CCTACCTTGGGGACATGACACTCTC T → A GAAATCCATGCGGTGATGACTGGAG
+331
Ser = Ser
n=
T/T=
T/A=
A/A=
A=
200
97
3
0
0.015
200
100
0
0
0.000
58
29
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
Exon 11: CodingPDE1 pubI
45559774 GRCh37
43347066 NCBI36
11291064
ACTGTGCTGGGAGCCTTCATAGCCT T → C TGGGGTAGGCATAGTCTGCTTGATC
Altered substrate specificity with respect to inosine and uridine. PMID: 19940846.
+355
Phe → Ser
(D=155)
n=
T/T=
T/C=
C/C=
C=
200
94
5
1
0.035
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDEIA
45559816 GRCh37
43347108 NCBI36
  
TGCTTGATCACTCCTGGGTGAACTC G → A AGTTGGGTTTGATAGAAACACTGAT
+ 
 
n=
G/G=
G/A=
A/A=
A=
200
60
36
4
0.220
200
100
0
0
0.000
60
30
0
0
0.000
20
9
1
0
0.050
14
6
1
0
0.071
Set-I
Exon 12: CodingPDE1 pub
45559935 GRCh37
43347227 NCBI36
12051140
GTGCTCTCGCCTCATCAAAGCTAGC G → A TATCCGGAAGTGGAGGAGTCCAAGT
+380
Ala = Ala
n=
G/G=
G/A=
A/A=
A=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 13: CodingPDE1 pub
45560519 GRCh37
43347811 NCBI36
13761311
CCTTTTTGGCTGTGTTGGCCTTCAT C → T AATGCTGCCCTCTCCTGGCTGGGGG
+437
Ile = Ile
n=
C/C=
C/T=
T/T=
T=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 14: CodingPDE1 pubI
45561551 GRCh37
43348843 NCBI36
14491384
TTTCACTCAGGTCATCTGCTCCTAT C → T TCCTAAGGCCCATGGTTTTCATGAT
+462
Leu → Phe
(D=22)
n=
C/C=
C/T=
T/T=
T=
200
98
2
0
0.010
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
45564654 GRCh37
43351946 NCBI36
  
AGGGTGATGGTTGGAGGAATAATAT G → A AGGAAGGTAGAATTGTCCTTGAGTA
+ 
 
n=
G/G=
G/A=
A/A=
A=
200
100
0
0
0.000
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
45567568 GRCh37
43354860 NCBI36
  
TGCTTGGTTCCTGTCTGACCCCTTA T → C GTACCTCTCTGGTTTTTCACTGCAG
+ 
 
n=
T/T=
T/C=
C/C=
C=
200
95
5
0
0.025
200
88
11
1
0.065
60
30
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
Exon 18: 3UTRPDE
45567855 GRCh37
43355147 NCBI36
2186 
TAAATGTAAAAGATTCATTTTGGGC C → T GGGCTCAGTGGCTCATGCCTGTAAT
+ 
 
n=
C/C=
C/T=
T/T=
T=
134
67
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272
Exon 18: 3UTRPDE
45567871 GRCh37
43355163 NCBI36
2202 
ATTTTGGGCCGGGCTCAGTGGCTCA T → C GCCTGTAATCCCAGCACTTTGGGAG
+ 
 
n=
T/T=
T/C=
C/C=
C=
134
10
32
25
0.612
136
9
34
25
0.618
136
59
9
0
0.066
136
22
35
11
0.419
n/a
0.000
PMT-272
Exon 18: 3UTRPDE
45567873 GRCh37
43355165 NCBI36
2204 
TTTGGGCCGGGCTCAGTGGCTCATG C → G CTGTAATCCCAGCACTTTGGGAGGC
+ 
 
n=
C/C=
C/G=
G/G=
G=
134
65
2
0
0.015
136
68
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
n/a
0.000
PMT-272
Exon 18: 3UTRPDE
45567983 GRCh37
43355275 NCBI36
2314 
CCCGTCTCTACTAAAAATACAAAAA A → AA TTAGCCGGGAGTGGTGTCGGGCGAC
+ 
 
n=
A/A=
A/AA=
AA/AA=
AA=
134
66
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272
Exon 18: 3UTRPDE
45568002 GRCh37
43355294 NCBI36
2333 
CAAAAAATTAGCCGGGAGTGGTGTC G → A GGCGACTGTAGTCCCAGCTACTCGC
+ 
 
n=
G/G=
G/A=
A/A=
A=
134
46
19
2
0.172
136
68
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
n/a
0.000
PMT-272
Exon 18: 3UTRPDE
45568123 GRCh37
43355415 NCBI36
2454 
ACTCCAGCCTGGGTGACAGAGCGAG A → G CTCTGTCTCAAAAAAAAAAAAAAAA
+ 
 
n=
A/A=
A/G=
G/G=
G=
134
67
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.