UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:CNT3
HGNC Symbol:SLC28A3
HGNC Description:solute carrier family 28 (concentrative nucleoside transporter), member 3
HGNC ID:16484
Superfamily:SLC
Chromosome:Chr.9(-): 86890765-86983413 GRCh37
Location:9q22.2
OMIM:608269
OMIM Phenotype:None
Accessions:AF305210.1
Nucleotide RefSeq:NM_022127
Protein RefSeq:NP_071410
Entrez:64078
Ensembl:ENSG00000197506
Isoforms:2
Evidence:None
Tissues:High: Pancreas, trachea, bone marrow, mammary gland; Low: intestine, lung, placenta, prostate, testis, liver
Type:protein-coding
Sets:II,IV
PharmGKB ID:PA426
HPRD ID:12200
Substrates:Uridine, Cytidine, Thymidine, Adenosine, Guanosine, Inosine, Cladribine, Gemcitabine, FdU, 5-fluorouridine, Zebularine, AZT, ddC, ddI
Trivial Names:CNT3
Transcripts:NM_022127.2 [Chr.9(-): 86890765-86983413 GRCh37]
NM_001199633.1 [Chr.9(-): 86890765-86955694 GRCh37]
ENST00000376238 [Chr.9(-): 86890372-86955598 GRCh37]
ENST00000495823 [Chr.9(-): 86920191-86955574 GRCh37]
ENST00000537648 [Chr.9(-): 86893028-86955672 GRCh37]
Annotation History:View Events (2)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC28A3.

Variant Data

View all PMT variants for SLC28A3 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC28A3 RESEQUENCING  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC28A3 RESEQUENCING
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 PDE
86983822 GRCh37
86173642 NCBI36
-409-28274
CTGGCATGACTTCATCTTCTACCCC C → - TCTCCCCAGTTCCTCCACCCTGACC
- 
 
n=
C/C=
C/-=
-/-=
-=
90
45
0
0
0.000
112
56
0
0
0.000
106
53
0
0
0.000
42
20
1
0
0.024
n/a
0.000
PMT-272
 PDE
86983759 GRCh37
86173579 NCBI36
-346-28211
TTCTGACATGACTTCATGTCCTAGG G → - CTGAACTGGGCCCAGAGACAGTGGA
- 
 
n=
G/G=
G/-=
-/-=
-=
90
45
0
0
0.000
112
55
1
0
0.009
106
51
2
0
0.019
40
16
4
0
0.100
n/a
0.000
PMT-272
 PDEI
86983672 GRCh37
86173492 NCBI36
-259-28124
TGAGACACCAGCTGGGGTGCCCCTC C → A TCTAACTCCAGGCTGCACAGCCCTC
- 
 
n=
C/C=
C/A=
A/A=
A=
90
39
6
0
0.067
110
42
11
2
0.136
102
35
13
3
0.186
32
12
4
0
0.125
n/a
0.000
PMT-272
PromoterPDE
86983646 GRCh37
86173466 NCBI36
-233-28098
TCTAACTCCAGGCTGCACAGCCCTC C → G GCTGCATAAGACACTCCTTCCTTCC
- 
 
n=
C/C=
C/G=
G/G=
G=
90
41
4
0
0.044
110
55
0
0
0.000
102
51
0
0
0.000
32
16
0
0
0.000
n/a
0.000
PMT-272
PromoterPDE
86983509 GRCh37
86173329 NCBI36
-96-27961
AGTTGTGAGGCCCCCATTCCAGGCC C → A CAGCTCCCAGATGACATTTCTAGAC
- 
 
n=
C/C=
C/A=
A/A=
A=
90
21
22
2
0.289
110
52
3
0
0.027
102
41
10
0
0.098
32
16
0
0
0.000
n/a
0.000
PMT-272
Promoter
Exon 1: 5UTR
PDEI
86983368 GRCh37
86173188 NCBI36
46-27820
ACCTGAACAACCAGCAGCGATACCC A → C GGTACTGTATCAGTGTGGGGGAAAA
- 
 
n=
A/A=
A/C=
C/C=
C=
90
13
25
7
0.433
110
52
3
0
0.027
102
41
10
0
0.098
32
16
0
0
0.000
n/a
0.000
PMT-272
 PDEI
86955610 GRCh37
86145430 NCBI36
 -62
GGTGGCTTTCTGACATCAGCAGAGA C → T TGGTGCTTTTTCCCAGGTACAAAGG
- 
 
n=
C/C=
C/T=
T/T=
T=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 2: CodingPDE1 pubI
86955538 GRCh37
86145358 NCBI36
10311
AGCAGCAAAAAGAGCATGGAGCTGA G → A GAGTACAGCAGCCCCCAGAGCTGAG
-4
Arg → Lys
(D=26)
n=
G/G=
G/A=
A/A=
A=
160
80
0
0
0.000
160
80
0
0
0.000
120
60
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
Exon 2: CodingPDE2 pubsI
86955535 GRCh37
86145355 NCBI36
10614
AGCAAAAAGAGCATGGAGCTGAGGA G → A TACAGCAGCCCCCAGAGCTGAGGGC
-5
Ser → Asn
(D=46)
n=
G/G=
G/A=
A/A=
A=
160
73
5
2
0.056
160
78
2
0
0.013
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDEI
86928403 GRCh37
86118223 NCBI36
  
AAGAACATCTGTCTTTTGGCTGTAA C → T TTTTTATTTTTTCAATCTGCACTTT
- 
 
n=
C/C=
C/T=
T/T=
T=
158
77
2
0
0.013
156
76
2
0
0.013
120
32
23
5
0.275
98
43
6
0
0.061
12
6
0
0
0.000
Set-II
Exon 3: CodingPDE2 pubsI
86928334 GRCh37
86118154 NCBI36
18896
ACTTTCTTGAGAACGAGAACACATC A → G GGAAACAACTCAATAAGAAGCAGAG
-32
Ser = Ser
n=
A/A=
A/G=
G/G=
G=
158
75
4
0
0.025
156
78
0
0
0.000
120
60
0
0
0.000
98
49
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 4: CodingPDE1 pub
86924602 GRCh37
86114422 NCBI36
276184
TGAAGAACAGGTCACAGTTGAGCAG G → C ATTCTCCAAGAAACAGAGAACACAT
-62
Asp → His
(D=81)
n=
G/G=
G/C=
C/C=
C=
156
77
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 4: CodingPDE1 pubI
86924586 GRCh37
86114406 NCBI36
292200
GTTGAGCAGGATTCTCCAAGAAACA G → A AGAACACATGGAGGATGATGATGAG
-67
Arg → Lys
(D=26)
n=
G/G=
G/A=
A/A=
A=
156
77
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
86924538 GRCh37
86114358 NCBI36
  
GAGGAGATGCAACAAAAAGGGTACA G → C TCTTTAAAACAGGGAAATAACCAAG
- 
 
n=
G/G=
G/C=
C/C=
C=
156
78
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 5: CodingPDE3 pubsIA
86920236 GRCh37
86110056 NCBI36
359267
GGTGTTTGGAAAGGAGGTATGACAC A → G GTATGTGGTTTCTGTAGGAAACACA
-89
Thr = Thr
n=
A/A=
A/G=
G/G=
G=
160
7
29
44
0.731
160
42
32
6
0.275
116
15
25
18
0.526
96
8
23
17
0.594
10
2
2
1
0.400
Set-II
 PDE
86920158 GRCh37
86109978 NCBI36
  
GCATTTTATTAGCAGGTAAATAACA A → - AGATGGTTAGGGATACCACTGTCTT
- 
 
n=
A/A=
A/-=
-/-=
-=
160
79
1
0
0.006
160
80
0
0
0.000
116
52
6
0
0.052
96
48
0
0
0.000
10
5
0
0
0.000
Set-II
 
86920157 GRCh37
86109977 NCBI36
  
CATTTTATTAGCAGGTAAATAACAA A → - GATGGTTAGGGATACCACTGTCTTT
- 
 
n=
A/A=
A/-=
-/-=
-=
160
79
1
0
0.006
160
80
0
0
0.000
116
52
6
0
0.052
96
48
0
0
0.000
10
5
0
0
0.000
Set-II
 PDEI
86917382 GRCh37
86107202 NCBI36
  
ATGATATTAAACCTCCCCTCACCTG C → T GCCAGAACAAGGCTGGAGCCTGGAG
- 
 
n=
C/C=
C/T=
T/T=
T=
160
44
32
4
0.250
160
52
24
4
0.200
120
46
12
2
0.133
100
28
14
8
0.300
12
3
2
1
0.333
Set-II
Exon 6: CodingPDE4 pubsI
86917301 GRCh37
86107121 NCBI36
430338
TCTGTTTTTGCTTCCTGGACAGGTT A → G TCTGGTTATGGTGATTTCGGCCTGT
-113
Tyr → Cys
(D=194)
n=
A/A=
A/G=
G/G=
G=
160
53
27
0
0.169
160
67
12
1
0.087
120
50
9
1
0.092
100
46
4
0
0.040
12
3
2
1
0.333
Set-II
 PDE1 pubI
86917088 GRCh37
86106908 NCBI36
  
TAAATGCAATTGGTTCTCTTATTTC A → G GTTAAGAGAGATAGTAGTCCTTTCC
- 
 
n=
A/A=
A/G=
G/G=
G=
160
71
9
0
0.056
160
71
9
0
0.056
120
60
0
0
0.000
100
35
12
3
0.180
12
6
0
0
0.000
Set-II
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 PDEI
86917056 GRCh37
86106876 NCBI36
  
AGAGATAGTAGTCCTTTCCAACACC G → A TTTCAAAAATTTGTTCTGAAATTGC
- 
 
n=
G/G=
G/A=
A/A=
A=
160
80
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE1 pubI
86912815 GRCh37
86102635 NCBI36
  
GGTTGGGCAGACAAGTTCAGGTAAG T → C TTGGTTCAAAAGAACACTTTGCTTT
- 
 
n=
T/T=
T/C=
C/C=
C=
160
80
0
0
0.000
158
78
1
0
0.006
118
37
20
2
0.203
100
44
6
0
0.060
12
6
0
0
0.000
Set-II
 PDEI
86912242 GRCh37
86102062 NCBI36
  
CTAATTTCCAGTCATGTGGTTGGAA T → A GAAATCTCTTTTTCTTTCTTTAACT
- 
 
n=
T/T=
T/A=
A/A=
A=
160
80
0
0
0.000
160
80
0
0
0.000
120
60
0
0
0.000
100
49
0
1
0.020
12
6
0
0
0.000
Set-II
 PDE
86912129 GRCh37
86101949 NCBI36
  
CCACTTCTTTGCATTTAAGGTAAAG T → C CAAACCTTTTTTCTATGTAGTCGCT
- 
 
n=
T/T=
T/C=
C/C=
C=
160
80
0
0
0.000
160
79
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDEI
86912119 GRCh37
86101939 NCBI36
  
GCATTTAAGGTAAAGTCAAACCTTT T → G TTCTATGTAGTCGCTGCTATTTCAG
- 
 
n=
T/T=
T/G=
G/G=
G=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 
86912030 GRCh37
86101850 NCBI36
  
TGACCAAAAACCAGGTATATACCTA C → CAC TGCGCTGGTCAGAGGTGTGCAATAC
- 
 
n=
C/C=
C/CAC=
CAC/CAC=
CAC=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDEI
86912026 GRCh37
86101846 NCBI36
  
CAAAAACCAGGTATATACCTACTGC G → A CTGGTCAGAGGTGTGCAATACATCA
- 
 
n=
G/G=
G/A=
A/A=
A=
160
80
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDEI
86911987 GRCh37
86101807 NCBI36
  
TGCAATACATCACTGCTCTTTTCCA C → T TGACAATGTTATCTGAAGTTAGTGG
- 
 
n=
C/C=
C/T=
T/T=
T=
160
32
39
9
0.356
160
80
0
0
0.000
120
54
6
0
0.050
100
47
3
0
0.030
12
6
0
0
0.000
Set-II
 PDEI
86909288 GRCh37
86099108 NCBI36
  
AGGAGTTTCCCATATTTTTATGATG T → C TTCAGAGGGAGAAAAGGAGACAGAG
- 
 
n=
T/T=
T/C=
C/C=
C=
160
78
2
0
0.013
160
80
0
0
0.000
120
60
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
Exon 10: CodingPDE1 pubI
86909182 GRCh37
86099002 NCBI36
962870
TGTTTCTGTCCCCACAGGTCCTGCC G → A ATCGTGGTTTTCTTCAGCACTGTGA
-290
Pro = Pro
n=
G/G=
G/A=
A/A=
A=
160
80
0
0
0.000
160
80
0
0
0.000
120
60
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
 PDEI
86909082 GRCh37
86098902 NCBI36
  
ACTGGGGCTGGGAGGGACTGGGTTA T → C AGGTGTAGAGCTGATTATCTCAGGC
- 
 
n=
T/T=
T/C=
C/C=
C=
160
65
15
0
0.094
160
62
18
0
0.113
120
43
17
0
0.142
100
29
18
3
0.240
12
4
2
0
0.167
Set-II
 PDE
86908988 GRCh37
86098808 NCBI36
  
TTTCTCTTCCTACCATTATCCACCA T → A CACCACCTAAGTGATTAGATTCAAA
- 
 
n=
T/T=
T/A=
A/A=
A=
160
25
43
12
0.419
160
66
14
0
0.087
120
30
24
6
0.300
100
40
9
1
0.110
12
3
3
0
0.250
Set-II
 PDE
86907746 GRCh37
86097566 NCBI36
  
TGTTGAAGCCCTCAATATTTTACAC C → T AGTTTAAGGATTTTAATCCCTACTT
- 
 
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
154
76
1
0
0.006
116
58
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
86907728 GRCh37
86097548 NCBI36
  
TTTACACCAGTTTAAGGATTTTAAT C → A CCTACTTTGAAGTTTTGGGTATACA
- 
 
n=
C/C=
C/A=
A/A=
A=
160
77
3
0
0.019
158
71
8
0
0.051
116
58
0
0
0.000
100
46
3
1
0.050
12
5
1
0
0.083
Set-II
 PDEI
86907699 GRCh37
86097519 NCBI36
  
ACTTTGAAGTTTTGGGTATACAAAA A → C GTTCTTTGCTGACTTTGTCCCTTTC
- 
 
n=
A/A=
A/C=
C/C=
C=
160
73
7
0
0.044
160
80
0
0
0.000
116
58
0
0
0.000
100
48
2
0
0.020
12
6
0
0
0.000
Set-II
 PDEI
86907673 GRCh37
86097493 NCBI36
  
GTTCTTTGCTGACTTTGTCCCTTTC T → A TCCTTTTAGGTTGGATGGATCATGC
- 
 
n=
T/T=
T/A=
A/A=
A=
160
49
28
3
0.212
160
80
0
0
0.000
116
58
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
Exon 11: CodingPDE1 pubI
86907624 GRCh37
86097444 NCBI36
1074982
GCTAGTTACTACGGGATCATCTCCT A → G TTGAATCTGTAGTTGCTTCTGGCAA
-328
Ile → Val
(D=29)
n=
A/A=
A/G=
G/G=
G=
160
71
9
0
0.056
160
80
0
0
0.000
116
58
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDEI
86907582 GRCh37
86097402 NCBI36
  
TTCTGGCAATATATTTGTTGGACAA G → A TAAGTTGTAATATCAACAGAACAAA
- 
 
n=
G/G=
G/A=
A/A=
A=
160
80
0
0
0.000
160
80
0
0
0.000
116
57
1
0
0.009
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDEI
86907537 GRCh37
86097357 NCBI36
  
AACAAAACATCTGTTGAAATGGATC G → T TCTCTTTCCAAAAAGCCAAATAAGA
- 
 
n=
G/G=
G/T=
T/T=
T=
160
70
10
0
0.063
160
80
0
0
0.000
116
52
6
0
0.052
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 12: CodingPDE1 pub
86905172 GRCh37
86094992 NCBI36
11381046
CAGACGGAGTCTCCACTGCTGGTCC G → A ACCATATTTACCTTACATCACCAAG
-349
Arg → Gln
(D=43)
n=
G/G=
G/A=
A/A=
A=
160
80
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
98
49
0
0
0.000
12
6
0
0
0.000
Set-II
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 12: CodingPDE1 pub
86905119 GRCh37
86094939 NCBI36
11911099
TGAACTCCACGCCATCATGACCGCC G → A GGTTCTCTACCATTGCTGGAAGCGT
Reduced uptake of inosine and thymidine in oocytes. PMID: 19940846.
-367
Gly → Arg
(D=125)
n=
G/G=
G/A=
A/A=
A=
160
80
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
98
49
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 12: CodingPDE1 pubI
86905096 GRCh37
86094916 NCBI36
12141122
CCGGGTTCTCTACCATTGCTGGAAG C → T GTGCTAGGTGCATACATTTCTTTTG
-374
Ser = Ser
n=
C/C=
C/T=
T/T=
T=
160
76
4
0
0.025
160
80
0
0
0.000
120
60
0
0
0.000
98
48
1
0
0.010
12
6
0
0
0.000
Set-II
 PDEI
86905035 GRCh37
86094855 NCBI36
  
GTTTTGGAATTATGAAAACACCAAC C → A TCTTCTTTCTTTATTATTGTTATTT
- 
 
n=
C/C=
C/A=
A/A=
A=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
98
49
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
86905027 GRCh37
86094847 NCBI36
  
ATTATGAAAACACCAACCTCTTCTT T → - CTTTATTATTGTTATTTCTTTTCTT
- 
 
n=
T/T=
T/-=
-/-=
-=
160
80
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
98
49
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
86904958 GRCh37
86094778 NCBI36
  
AAGGAGGCCAAGAGAGTGTCTTTTT T → C TGCCATATGGCAAAAGTTGGTCACA
- 
 
n=
T/T=
T/C=
C/C=
C=
160
80
0
0
0.000
158
77
2
0
0.013
118
59
0
0
0.000
98
48
1
0
0.010
12
6
0
0
0.000
Set-II
 PDEI
86903205 GRCh37
86093025 NCBI36
  
ACCTCCAAAGAAACATTGTCTTCTG G → T AATAGAAACAACCCCTGCCCTGTTT
- 
 
n=
G/G=
G/T=
T/T=
T=
160
73
7
0
0.044
160
80
0
0
0.000
118
59
0
0
0.000
100
48
2
0
0.020
10
5
0
0
0.000
Set-II
 PDE
86903162 GRCh37
86092982 NCBI36
  
CCCTGTTTCTTCCCTTGCGGAGCTC T → C TGGACCCTTCCTCTGAACACAAGAA
- 
 
n=
T/T=
T/C=
C/C=
C=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDEI
86903151 GRCh37
86092971 NCBI36
  
CCCTTGCGGAGCTCTTGGACCCTTC C → T TCTGAACACAAGAAAAAAGCTAATC
- 
 
n=
C/C=
C/T=
T/T=
T=
160
76
4
0
0.025
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
86903128 GRCh37
86092948 NCBI36
  
TCCTCTGAACACAAGAAAAAAGCTA A → G TCCCAGGTTTGCCTTCTTTCTTCTG
- 
 
n=
A/A=
A/G=
G/G=
G=
160
80
0
0
0.000
160
80
0
0
0.000
120
58
2
0
0.017
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
86903123 GRCh37
86092943 NCBI36
  
TGAACACAAGAAAAAAGCTAATCCC A → G GGTTTGCCTTCTTTCTTCTGAAATT
- 
 
n=
A/A=
A/G=
G/G=
G=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 13: CodingPDE1 pubI
86902991 GRCh37
86092811 NCBI36
13441252
TGAGACAGAAAAACCTAAAATAACC C → A TCAAGAATGCCATGAAAATGGAAAG
-418
Leu → Ile
(D=5)
n=
C/C=
C/A=
A/A=
A=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
86902915 GRCh37
86092735 NCBI36
  
ATTAATGACTACCCAAGCCGGGGCG G → A GGGACTCCAGGAGTCAATGTACAGC
- 
 
n=
G/G=
G/A=
A/A=
A=
160
80
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDEIA
86901116 GRCh37
86090936 NCBI36
  
CAGGGGCCTTAGAGTTTGTCTCTTA T → C CTAAGCTCTGATTATGCTACTTCTG
- 
 
n=
T/T=
T/C=
C/C=
C=
160
76
4
0
0.025
160
80
0
0
0.000
114
57
0
0
0.000
100
49
1
0
0.010
10
5
0
0
0.000
Set-II
 PDEIA
86901058 GRCh37
86090878 NCBI36
  
GGTGTCCATCCCCTGACAACTCCTT G → A GTAATTCTGGAATTGCTATTTCTTG
- 
 
n=
G/G=
G/A=
A/A=
A=
160
79
1
0
0.006
160
80
0
0
0.000
114
57
0
0
0.000
100
49
1
0
0.010
10
5
0
0
0.000
Set-II
Exon 14: CodingPDE4 pubsIA
86900926 GRCh37
86090746 NCBI36
14731381
GAATCTGATTGCCTTCCTGGCCCTG C → T TGTCTTTTATGAATTCAGCCCTGTC
-461
Leu = Leu
n=
C/C=
C/T=
T/T=
T=
160
38
36
6
0.300
160
59
21
0
0.131
114
42
15
0
0.132
100
28
19
3
0.250
10
3
2
0
0.200
Set-II
 PDE
86900842 GRCh37
86090662 NCBI36
  
GAGTTTTGAGGTATAATCACATCAC G → A CCCCTGCCCTCTGTTTTGTTTCTGC
- 
 
n=
G/G=
G/A=
A/A=
A=
160
79
1
0
0.006
160
80
0
0
0.000
114
57
0
0
0.000
100
50
0
0
0.000
10
5
0
0
0.000
Set-II
 PDEIA
86895853 GRCh37
86085673 NCBI36
  
TCAAAATGAAGCCCAGTTGGATGTC A → G GATTTGTTAAGCCAGCTCAGATTGT
- 
 
n=
A/A=
A/G=
G/G=
G=
160
69
11
0
0.069
160
59
21
0
0.131
120
43
17
0
0.142
100
29
18
3
0.240
12
4
2
0
0.167
Set-II
Exon 16: CodingPDE1 pubI
86895771 GRCh37
86085591 NCBI36
17661674
TTCGTTCTGAGATAATCGCCACTTA C → T GCTCTCTGTGGTTTTGCCAATATCG
-558
Tyr = Tyr
n=
C/C=
C/T=
T/T=
T=
160
79
1
0
0.006
160
80
0
0
0.000
120
54
6
0
0.050
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 17: CodingPDE1 pubI
86894964 GRCh37
86084784 NCBI36
18461754
GCATCCATGGCTCCTTCCAGAAAGC G → A TGATATCGCCTCGGGGGCAGTGAGA
-585
Arg → His
(D=29)
n=
G/G=
G/A=
A/A=
A=
158
78
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDEI
86894852 GRCh37
86084672 NCBI36
  
GTCCTTTGTGTCCCAGTGCCCACAG G → A ATGAATGGCAGCTTTCAGGACAGGC
- 
 
n=
G/G=
G/A=
A/A=
A=
158
79
0
0
0.000
160
79
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 PDEI
86893325 GRCh37
86083145 NCBI36
  
TGCCCTGAACTATTTTTAATGTCAT T → C GTCTGCTCACCTACTGTTTCTGCCA
- 
 
n=
T/T=
T/C=
C/C=
C=
158
76
3
0
0.019
158
79
0
0
0.000
120
60
0
0
0.000
98
49
0
0
0.000
10
5
0
0
0.000
Set-II
 PDEI
86893313 GRCh37
86083133 NCBI36
  
TTTTTAATGTCATTGTCTGCTCACC T → C ACTGTTTCTGCCATCTATGGCTCAT
- 
 
n=
T/T=
T/C=
C/C=
C=
158
37
37
5
0.297
158
58
21
0
0.133
120
43
15
2
0.158
98
27
19
3
0.255
10
4
1
0
0.100
Set-II

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.