UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:ENT1
HGNC Symbol:SLC29A1
HGNC Description:solute carrier family 29 (equilibrative nucleoside transporter), member 1
HGNC ID:11003
Superfamily:SLC
Chromosome:Chr.6(+): 44187242-44201888 GRCh37
Location:6p21.1
OMIM:602193
OMIM Phenotype:None
Accessions:U81375
Nucleotide RefSeq:NM_001078174
Protein RefSeq:NP_001071642
Entrez:2030
Ensembl:ENSG00000112759
Isoforms:13
Evidence:None
Tissues:Ubiquitous
Type:protein-coding
Sets:I,IV
PharmGKB ID:PA154
HPRD ID:03724
Substrates:ddI, ddC, Pyrimidine/purine nucleosides
Trivial Names:ENT1
Transcripts:NM_004955.2 [Chr.6(+): 44187242-44201888 GRCh37]
NM_001078174.1 [Chr.6(+): 44187242-44201888 GRCh37]
NM_001078175.2 [Chr.6(+): 44191241-44201888 GRCh37]
NM_001078176.2 [Chr.6(+): 44191241-44201888 GRCh37]
NM_001078177.1 [Chr.6(+): 44191363-44201888 GRCh37]
XM_005248878.1 [Chr.6(+): 44187352-44201886 GRCh37]
XM_005248875.1 [Chr.6(+): 44187373-44201886 GRCh37]
XM_005248877.1 [Chr.6(+): 44191241-44201887 GRCh37]
XM_005248876.1 [Chr.6(+): 44191284-44201886 GRCh37]
XM_005248880.1 [Chr.6(+): 44191303-44201886 GRCh37]
XM_005248879.1 [Chr.6(+): 44191591-44201886 GRCh37]
XM_005248881.1 [Chr.6(+): 44194494-44201886 GRCh37]
XM_005248882.1 [Chr.6(+): 44194554-44201886 GRCh37]
ENST00000313248 [Chr.6(+): 44187373-44201879 GRCh37]
ENST00000371708 [Chr.6(+): 44194876-44201878 GRCh37]
ENST00000371713 [Chr.6(+): 44191560-44201878 GRCh37]
ENST00000371724 [Chr.6(+): 44191560-44201878 GRCh37]
ENST00000371731 [Chr.6(+): 44191351-44201878 GRCh37]
ENST00000371740 [Chr.6(+): 44191302-44201878 GRCh37]
ENST00000371755 [Chr.6(+): 44191302-44201878 GRCh37]
ENST00000393841 [Chr.6(+): 44191363-44201888 GRCh37]
ENST00000393844 [Chr.6(+): 44187242-44201888 GRCh37]
ENST00000427851 [Chr.6(+): 44187393-44201878 GRCh37]
ENST00000472176 [Chr.6(+): 44197326-44200142 GRCh37]
Annotation History:View Events (80)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC29A1.

Variant Data

View all PMT variants for SLC29A1 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC29A1 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC29A1 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 PDE1 pub
44186941 GRCh37
44294919 NCBI36
-301-8110
AGGACAGTGAGGAGTACAGGATCCA A → G TTGGGATTCCAGTCCCCTCCCCACA
+ 
 
n=
A/A=
A/G=
G/G=
G=
200
100
0
0
0.000
200
100
0
0
0.000
58
28
1
0
0.017
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
PromoterPDE
44187032 GRCh37
44295010 NCBI36
-210-8019
CTATCCGCCCCACCCCCAGCCCTGC G → A GGGCTTTCTGCCTGCCACACGCCGT
+ 
 
n=
G/G=
G/A=
A/A=
A=
200
100
0
0
0.000
200
98
2
0
0.010
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
PromoterPDE
44187039 GRCh37
44295017 NCBI36
-203-8012
CCCCACCCCCAGCCCTGCGGGGCTT T → TT CTGCCTGCCACACGCCGTCCCTGCT
+ 
 
n=
T/T=
T/TT=
TT/TT=
TT=
200
100
0
0
0.000
200
99
1
0
0.005
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
PromoterPDE
44187087 GRCh37
44295065 NCBI36
-155-7964
GCTCACTACCCCATCGGTTTCCTTC G → C GGAGTCTTCAAAGCCAGTGCACGTG
+ 
 
n=
G/G=
G/C=
C/C=
C=
200
100
0
0
0.000
200
99
1
0
0.005
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
PromoterPDE
44187134 GRCh37
44295112 NCBI36
-108-7917
CGTGCTCCCAGGTCTCAGGGAGGCG A → G CCCAGGGGGAGGGGCAGAGAGAAGG
+ 
 
n=
A/A=
A/G=
G/G=
G=
200
99
1
0
0.005
200
100
0
0
0.000
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Promoter
Exon 1: 5UTR
PDE
44187276 GRCh37
44295254 NCBI36
35-7775
CTCCCACTGAGTCGGCTCTGGTCTC C → A CCGCCCCTGAGCCGCGAGGACTGGA
+ 
 
n=
C/C=
C/A=
A/A=
A=
200
100
0
0
0.000
200
99
1
0
0.005
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 1: 5UTRPDE
44187386 GRCh37
44295364 NCBI36
145-7665
GCCCGGCGGCCCACACCGGTCAGGC C → T CGGCGCGGGCTGCGCTCTCCAGCTG
+ 
 
n=
C/C=
C/T=
T/T=
T=
200
95
5
0
0.025
200
86
14
0
0.070
58
29
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
Exon 1: 5UTRPDE
44187402 GRCh37
44295380 NCBI36
161-7649
CGGTCAGGCCCGGCGCGGGCTGCGC T → TT CTCCAGCTGTGGCTATGGCCCCAGC
+ 
 
n=
T/T=
T/TT=
TT/TT=
TT=
200
97
3
0
0.015
200
92
8
0
0.040
58
29
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
Exon 3: CodingPDE1 pubI
44197181 GRCh37
44305159 NCBI36
41684
TGCTGGGTCTGGGAACGCTGCTCCC G → A TGGAATTTTTTCATGACGGCCACTC
+28
Pro = Pro
n=
G/G=
G/A=
A/A=
A=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
 PDE1 pub
44197802 GRCh37
44305780 NCBI36
  
ATTAATTGTAAGCTGGGCCAGGAGG G → A GGCCTATGGGAGGAGGCATGCCCAA
+ 
 
n=
G/G=
G/A=
A/A=
A=
200
92
8
0
0.040
200
99
1
0
0.005
60
30
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
 PDE1 pub
44198288 GRCh37
44306266 NCBI36
  
AGAGGGGATGGGGCCTGTCTCTGAT C → G ACTGACACCACCCCAGGTGGCTCGG
+ 
 
n=
C/C=
C/G=
G/G=
G=
200
99
1
0
0.005
192
96
0
0
0.000
60
30
0
0
0.000
18
9
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE1 pub
44198296 GRCh37
44306274 NCBI36
  
TGGGGCCTGTCTCTGATCACTGACA C → T CACCCCAGGTGGCTCGGAGCTATCA
+ 
 
n=
C/C=
C/T=
T/T=
T=
200
99
1
0
0.005
192
96
0
0
0.000
60
30
0
0
0.000
18
9
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 7: CodingPDE1 pubI
44198312 GRCh37
44306290 NCBI36
929597
TCACTGACACCACCCCAGGTGGCTC G → A GAGCTATCAGAAAGTGCCTTCGGCT
+199
Ser = Ser
n=
G/G=
G/A=
A/A=
A=
200
99
1
0
0.005
192
96
0
0
0.000
60
30
0
0
0.000
18
9
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 7: CodingPDE2 pubs
44198362 GRCh37
44306340 NCBI36
979647
TACTTTATCACAGCCTGTGCTGTTA T → C CATTTTGACCATCATCTGTTACCTG
+216
Ile → Thr
(D=89)
n=
T/T=
T/C=
C/C=
C=
200
99
1
0
0.005
192
92
4
0
0.021
60
30
0
0
0.000
18
8
1
0
0.056
14
7
0
0
0.000
Set-I
Exon 7: CodingPDE1 pubI
44198402 GRCh37
44306380 NCBI36
1019687
TCTGTTACCTGGGCCTGCCCCGCCT G → A GTGAGTAAATGGAGGGAGCTGGGGT
+229
Leu = Leu
n=
G/G=
G/A=
A/A=
A=
200
99
1
0
0.005
192
96
0
0
0.000
60
30
0
0
0.000
18
9
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE1 pub
44199096 GRCh37
44307074 NCBI36
  
CACAACTTGGAGATTTCTTCCATCC C → T GCAGGAGAGGAGCCAAGAGCAGGCA
+ 
 
n=
C/C=
C/T=
T/T=
T=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE1 pubI
44199202 GRCh37
44307180 NCBI36
  
TATCAAAGCCATCCTGAAAAATGTA C → T GTAGGGGAGGTTATCCTATCTTCTA
+ 
 
n=
C/C=
C/T=
T/T=
T=
200
89
11
0
0.055
200
99
1
0
0.005
60
30
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
 PDE1 pub
44199911 GRCh37
44307889 NCBI36
  
TTGAGTTGGGCTGGAAGTGGGGAAG G → A GAGGGAGCCTGGGTCACCTTCTCCC
+ 
 
n=
G/G=
G/A=
A/A=
A=
198
92
7
0
0.035
198
99
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE1 pub
44199946 GRCh37
44307924 NCBI36
  
TGGGTCACCTTCTCCCCGTTTCCTG G → A GTCCATTTGCCCTTCCCTGGGCTGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
198
89
10
0
0.051
198
99
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 11: CodingPDE1 pubI
44200105 GRCh37
44308083 NCBI36
1331999
AACGTTACTTCATTCCTGTGTCCTG T → C TTCTTGACTTTCAATATCTTTGACT
+333
Cys = Cys
n=
T/T=
T/C=
C/C=
C=
198
99
0
0
0.000
198
98
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 PDE1 pub
44200511 GRCh37
44308489 NCBI36
  
GGGCCTGGCTGTGCCCTGGGGTGGC G → A GCCTGGGCTGAGGCCCTGCCTGGTG
+ 
 
n=
G/G=
G/A=
A/A=
A=
194
95
2
0
0.010
194
97
0
0
0.000
54
27
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 12: CodingPDE2 pubs
44200655 GRCh37
44308633 NCBI36
15031171
CCGCCGCTACCTGACTGTGGTCTTC G → A AGCACGATGCCTGGTTCATCTTCTT
+391
Glu → Lys
(D=56)
n=
G/G=
G/A=
A/A=
A=
194
95
2
0
0.010
196
98
0
0
0.000
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 13: 3UTRPDE1 pub
44201311 GRCh37
44309289 NCBI36
1749 
TGCCTGCCTCCCTCCCTGTCTGCCT C → A CTGCCCCTTCCTTCTGCCAGGGGTG
+ 
 
n=
C/C=
C/A=
A/A=
A=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 13: 3UTRPDE2 pubsI
44201734 GRCh37
44309712 NCBI36
2172 
CTCCTCCTCTGTGTTCTCTCCATGT C → A CCCCTCCCAACTCCCCATGCCCAGT
+ 
 
n=
C/C=
C/A=
A/A=
A=
200
99
1
0
0.005
196
98
0
0
0.000
60
17
13
0
0.217
20
8
2
0
0.100
14
5
2
0
0.143
Set-I
Exon 13: 3UTRPDE
44201807 GRCh37
44309785 NCBI36
2245 
ACAGTTGCCACGTTACTGCCTTTTT T → A AAAAATATATTTGACAGAAACCAGG
+ 
 
n=
T/T=
T/A=
A/A=
A=
200
91
9
0
0.045
196
98
0
0
0.000
60
29
1
0
0.017
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE1 pub
44201920 GRCh37
44309898 NCBI36
  
GTCCTCCAGCCGTGGCTTCATGCCC T → C GGAGTGGGTAGAGGGCTGGCAGCCT
+ 
 
n=
T/T=
T/C=
C/C=
C=
200
100
0
0
0.000
196
98
0
0
0.000
60
29
1
0
0.017
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
44201947 GRCh37
44309925 NCBI36
  
GAGTGGGTAGAGGGCTGGCAGCCTG A → C GTCTGGGAGATGAGCATGACCCAGC
+ 
 
n=
A/A=
A/C=
C/C=
C=
200
37
50
13
0.380
196
56
36
6
0.245
60
15
15
0
0.250
20
8
2
0
0.100
14
2
3
2
0.500
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.