UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:ENT2
HGNC Symbol:SLC29A2
HGNC Description:solute carrier family 29 (equilibrative nucleoside transporter), member 2
HGNC ID:11004
Superfamily:SLC
Chromosome:Chr.11(-): 66129992-66139961 GRCh37
Location:11q13
OMIM:602110
OMIM Phenotype:None
Accessions:AF029358
Nucleotide RefSeq:NM_001532
Protein RefSeq:NP_001523
Entrez:3177
Ensembl:ENSG00000174669
Isoforms:2
Evidence:None
Tissues:Ubiquitous; very abundant in skeletal muscle
Type:protein-coding
Sets:I,IV
PharmGKB ID:PA191
HPRD ID:03662
Substrates:Purine and pyimidine nucleosides/nucleobases, AZT, ddC, ddI
Trivial Names:ENT2, DER12, HNP36
Transcripts:NM_001532.2 [Chr.11(-): 66129992-66139291 GRCh37]
XM_005273964.1 [Chr.11(-): 66129992-66139961 GRCh37]
ENST00000311161 [Chr.11(-): 66129992-66139570 GRCh37]
ENST00000357440 [Chr.11(-): 66129993-66139291 GRCh37]
ENST00000540386 [Chr.11(-): 66129993-66139291 GRCh37]
ENST00000541567 [Chr.11(-): 66129994-66139118 GRCh37]
ENST00000544554 [Chr.11(-): 66129993-66139645 GRCh37]
ENST00000546034 [Chr.11(-): 66129994-66139685 GRCh37]
Annotation History:View Events (12)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC29A2.

Variant Data

View all PMT variants for SLC29A2 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC29A2 RESEQUENCING  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC29A2 RESEQUENCING
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 PDEI
66139854 GRCh37
65896430 NCBI36
-563-792
CGATACGCCCGGGGATTGCAGAGAA T → C CCACACCTATTCGTAGATTATGAGA
- 
 
n=
T/T=
T/C=
C/C=
C=
134
39
24
4
0.239
136
68
0
0
0.000
134
67
0
0
0.000
132
66
0
0
0.000
n/a
0.000
PMT-272
 PDE
66139814 GRCh37
65896390 NCBI36
-523-752
AGATTATGAGAGTAGGAGCAAATTA A → G TGATTTATAGTCTTTTCAAATTTTT
- 
 
n=
A/A=
A/G=
G/G=
G=
134
66
1
0
0.007
136
68
0
0
0.000
134
67
0
0
0.000
132
66
0
0
0.000
n/a
0.000
PMT-272
 PDE
66139696 GRCh37
65896272 NCBI36
-405-634
CAGCGCGGCGAAGCCCGCCAGGATC G → T CGGGCGACCTGTGGCAGCTCTGGTT
- 
 
n=
G/G=
G/T=
T/T=
T=
132
66
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
134
67
0
0
0.000
n/a
0.000
PMT-272
 PDE
66139640 GRCh37
65896216 NCBI36
-349-578
GGAGCCGCTGCGGAGTCCCCGCCCA G → C AGCGTAACCCGAGCCGGGCCCGGGC
+ 
 
n=
G/G=
G/C=
C/C=
C=
136
65
2
1
0.029
136
65
3
0
0.022
136
52
14
2
0.132
136
65
3
0
0.022
n/a
0.000
PMT-272
 PDE
66139605 GRCh37
65896181 NCBI36
-314-543
TAAAGCTGGAACCCACCGGGGCGCC C → A CCTAACTAGGGAGCCGCTGCGGAGT
+ 
 
n=
C/C=
C/A=
A/A=
A=
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
n/a
0.000
PMT-272
 PDE
66139578 GRCh37
65896154 NCBI36
-287-516
TGATGCCAGAGCCGCTCCTGCGACC C → G CTAAAGCTGGAACCCACCGGGGCGC
+ 
 
n=
C/C=
C/G=
G/G=
G=
136
68
0
0
0.000
136
68
0
0
0.000
136
65
3
0
0.022
136
68
0
0
0.000
n/a
0.000
PMT-272
PromoterPDE
66139487 GRCh37
65896063 NCBI36
-196-425
GGACGAGGTGTAACCTCACCTCCAC C → G CCCCGCCGAGAGCTCTGTAGGGGCA
+ 
 
n=
C/C=
C/G=
G/G=
G=
136
68
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
n/a
0.000
PMT-272
PromoterPDE
66139310 GRCh37
65895886 NCBI36
-19-248
CGCCACCCGTCTCTCCTTCCCCCAC C → T CGCCTCAGGGACTCGACTCTGGCTC
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
56
11
1
0.096
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272
PromoterPDE
66139295 GRCh37
65895871 NCBI36
-4-233
GGGGACAGAGGGTCGCGCCACCCGT C → T TCTCCTTCCCCCACCCGCCTCAGGG
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
66
2
0
0.015
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272
Exon 1: 5UTR
Promoter
PDE
66139265 GRCh37
65895841 NCBI36
27-203
CAGGCTGGGACCTGGGCTCCGCCCC G → A AGGCGGGGACAGAGGGTCGCGCCAC
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
66
2
0
0.015
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272
Exon 1: 5UTRPDE
66139187 GRCh37
65895763 NCBI36
105-125
GTCTCCCCAGATTCCGGTGCAGGGC G → T GCTGGAGTCGCACAGGTAGCCTCGG
+ 
 
n=
G/G=
G/T=
T/T=
T=
136
67
1
0
0.007
136
66
2
0
0.015
136
68
0
0
0.000
136
67
1
0
0.007
n/a
0.000
PMT-272
Exon 1: CodingPDE1 pub
66139050 GRCh37
65895626 NCBI36
24213
CGCCGCGGCGGCCATGGCGCGAGGA G → T ACGCCCCGCGGGACAGGTGAGTGGG
Reduced uptake of guanosine and inosine in oocytes. PMID: 19940846.
-5
Asp → Tyr
(D=160)
n=
G/G=
G/T=
T/T=
T=
192
95
1
0
0.005
186
93
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
66139011 GRCh37
65895587 NCBI36
  
GGGTCTGCAACGCCCCCGGCCACTT G → A CAACGCACCCGGGCCCACTCACCTG
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272
Exon 3: CodingPDE1 pub
66136974 GRCh37
65893550 NCBI36
370141
TCCAGGCGCGACTGGCCGGGGCCGG C → G AACAGCACAGCCAGGATCCTGAGCA
-47
Gly = Gly
n=
C/C=
C/G=
G/G=
G=
200
97
3
0
0.015
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 3: CodingPDE1 pubI
66136938 GRCh37
65893514 NCBI36
406177
CCAGGATCCTGAGCACCAACCACAC G → A GGTCCCGAGGATGCCTTCAACTTCA
-59
Thr = Thr
n=
G/G=
G/A=
A/A=
A=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 3: CodingPDEI
66136911 GRCh37
65893487 NCBI36
433204
GTCCCGAGGATGCCTTCAACTTCAA C → A AATTGGGTGACGCTGCTGTCCCAGC
-68
Asn → Lys
(D=94)
n=
C/C=
C/A=
A/A=
A=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 4: CodingPDE1 pubI
66136665 GRCh37
65893241 NCBI36
510281
CTCTGCCTGCTTCTGAGCAGCGTCC C → T GGAGACGGTGCGCATTCTGGGCAGC
-94
Pro → Leu
(D=98)
n=
C/C=
C/T=
T/T=
T=
190
95
0
0
0.000
180
89
1
0
0.006
54
27
0
0
0.000
20
10
0
0
0.000
10
5
0
0
0.000
Set-I
Exon 4: CodingPDE1 pubI
66136658 GRCh37
65893234 NCBI36
517288
TGCTTCTGAGCAGCGTCCCGGAGAC G → A GTGCGCATTCTGGGCAGCCTGCTGG
-96
Thr = Thr
n=
G/G=
G/A=
A/A=
A=
190
94
1
0
0.005
180
90
0
0
0.000
54
27
0
0
0.000
20
10
0
0
0.000
10
5
0
0
0.000
Set-I
Exon 6: CodingPDE1 pub
66135340 GRCh37
65891916 NCBI36
780551
TTCTGCAGCTGAAGTTCCTCCGCAG G → - TGGCGTGGACGCCGAGACCTCTGCC
-184
Ser → DEL
n=
G/G=
G/-=
-/-=
-=
200
100
0
0
0.000
200
99
1
0
0.005
56
28
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 6: CodingPDE1 pub
66135339 GRCh37
65891915 NCBI36
781552
TCTGCAGCTGAAGTTCCTCCGCAGG T → - GGCGTGGACGCCGAGACCTCTGCCC
-184
Ser → DEL
n=
T/T=
T/-=
-/-=
-=
200
100
0
0
0.000
200
99
1
0
0.005
56
28
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 6: CodingPDE1 pub
66135338 GRCh37
65891914 NCBI36
782553
CTGCAGCTGAAGTTCCTCCGCAGGT G → - GCGTGGACGCCGAGACCTCTGCCCT
-185
Gly → DEL
n=
G/G=
G/-=
-/-=
-=
200
100
0
0
0.000
200
99
1
0
0.005
56
28
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 6: CodingPDE1 pub
66135337 GRCh37
65891913 NCBI36
783554
TGCAGCTGAAGTTCCTCCGCAGGTG G → - CGTGGACGCCGAGACCTCTGCCCTG
-185
Gly → DEL
n=
G/G=
G/-=
-/-=
-=
200
100
0
0
0.000
200
99
1
0
0.005
56
28
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 6: CodingPDE1 pub
66135336 GRCh37
65891912 NCBI36
784555
GCAGCTGAAGTTCCTCCGCAGGTGG C → - GTGGACGCCGAGACCTCTGCCCTGG
-185
Gly → DEL
n=
C/C=
C/-=
-/-=
-=
200
100
0
0
0.000
200
99
1
0
0.005
56
28
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 6: Coding1 pub
66135335 GRCh37
65891911 NCBI36
785556
CAGCTGAAGTTCCTCCGCAGGTGGC G → - TGGACGCCGAGACCTCTGCCCTGGG
-186
Val → DEL
n=
G/G=
G/-=
-/-=
-=
200
100
0
0
0.000
200
99
1
0
0.005
56
28
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE1 pub
66134085 GRCh37
65890661 NCBI36
  
TCTCCCTTCGTTGGGCCTGGCTGTC G → A GGAAACCTGGGTCACAAGCATGACC
- 
 
n=
G/G=
G/A=
A/A=
A=
194
83
13
1
0.077
198
51
41
7
0.278
58
13
14
2
0.310
20
7
3
0
0.150
12
4
2
0
0.167
Set-I
Exon 8: CodingPDE1 pubI
66133974 GRCh37
65890550 NCBI36
1024795
CTCTGACCCTGGATCTTGACCTGGA G → A AAGGAGCCGGAATCAGAGCCAGATG
-265
Glu = Glu
n=
G/G=
G/A=
A/A=
A=
200
100
0
0
0.000
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 8: CodingPDE1 pub
66133924 GRCh37
65890500 NCBI36
1074845
GAGCCCCAGAAGCCAGGAAAACCTT C → - AGTCTTCACTGTCTTCCAGAAGGTT
Reduced uptake of guanosine and inosine in oocytes. PMID: 19940846.
-282
Ser → DEL
n=
C/C=
C/-=
-/-=
-=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 8: CodingPDE1 pub
66133923 GRCh37
65890499 NCBI36
1075846
AGCCCCAGAAGCCAGGAAAACCTTC A → - GTCTTCACTGTCTTCCAGAAGGTTT
Reduced uptake of guanosine and inosine in oocytes. PMID: 19940846.
-282
Ser → DEL
n=
A/A=
A/-=
-/-=
-=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 9: CodingPDE1 pub
66133643 GRCh37
65890219 NCBI36
1156927
TCACAGTCACCCTGTCCGTCTTCCC C → T GCCATCACAGCCATGGTGACCAGCT
-309
Pro = Pro
n=
C/C=
C/T=
T/T=
T=
198
91
7
1
0.045
198
99
0
0
0.000
54
27
0
0
0.000
14
7
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE1 pubI
66133380 GRCh37
65889956 NCBI36
  
TAAGCACACCAGGGCTGGGTGATCC G → A ATGTTTTAGGAAGCAGTTTGGGATC
- 
 
n=
G/G=
G/A=
A/A=
A=
192
95
1
0
0.005
194
97
0
0
0.000
34
17
0
0
0.000
14
7
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE1 pubI
66131906 GRCh37
65888482 NCBI36
  
CTCCAGGGACCATGCTGACTTCAGC T → C TCTACCACAGCCAGACGAGGACAGC
- 
 
n=
T/T=
T/C=
C/C=
C=
200
2
10
88
0.930
196
0
0
98
1.000
60
0
0
30
1.000
20
0
0
10
1.000
14
0
0
7
1.000
Set-I
Exon 11: CodingPDE1 pubI
66131722 GRCh37
65888298 NCBI36
14621233
TTGCCGTTTCTAATGGCTACCTGGT G → A TCCCTCACCATGTGCCTGGCGCCCA
-411
Val = Val
n=
G/G=
G/A=
A/A=
A=
200
99
1
0
0.005
196
98
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 12: 3UTR
66130847 GRCh37
65887423 NCBI36
1660 
CAAGCTCGCCATTCGCCCTGGGCTG G → A ATCTCAGCTCCGGAAGGAGACGTCG
+ 
 
n=
G/G=
G/A=
A/A=
A=
134
67
0
0
0.000
136
65
3
0
0.022
134
67
0
0
0.000
132
65
1
0
0.008
n/a
0.000
PMT-272
Exon 12: 3UTR
66130736 GRCh37
65887312 NCBI36
1771 
AATGACCGGTGGTGATTTCTTCCCC A → G CAGCACTCCAAGTGGATGAAGAGCA
+ 
 
n=
A/A=
A/G=
G/G=
G=
134
3
18
46
0.821
136
0
0
68
1.000
134
0
0
67
1.000
132
0
0
66
1.000
n/a
0.000
PMT-272
Exon 12: 3UTR
66130718 GRCh37
65887294 NCBI36
1789 
TTCCTGGGTGAGGGTTAGAATGACC G → A GTGGTGATTTCTTCCCCACAGCACT
+ 
 
n=
G/G=
G/A=
A/A=
A=
134
67
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
132
63
3
0
0.023
n/a
0.000
PMT-272
Exon 12: 3UTR
66130717 GRCh37
65887293 NCBI36
1790 
ATTCCTGGGTGAGGGTTAGAATGAC C → T GGTGGTGATTTCTTCCCCACAGCAC
+ 
 
n=
C/C=
C/T=
T/T=
T=
134
66
1
0
0.007
136
65
3
0
0.022
134
67
0
0
0.000
132
64
2
0
0.015
n/a
0.000
PMT-272
Exon 12: 3UTR
66130628 GRCh37
65887204 NCBI36
1879 
GCAGACCTGGTGGTGGGGAGCAGCC G → A TGCCCTGCACCCTCTTTTCCCTAGT
+ 
 
n=
G/G=
G/A=
A/A=
A=
134
65
2
0
0.015
136
68
0
0
0.000
134
67
0
0
0.000
132
66
0
0
0.000
n/a
0.000
PMT-272
Exon 12: 3UTR
66130548 GRCh37
65887124 NCBI36
1959 
AGGCGCTCCTGGCCTGGGCTGGCCC C → T GCCTCCCACTCTGAACCCTCTGGTC
+ 
 
n=
C/C=
C/T=
T/T=
T=
134
41
23
3
0.216
136
4
29
35
0.728
134
14
27
26
0.590
132
7
19
40
0.750
n/a
0.000
PMT-272
Exon 12: 3UTR
66130485 GRCh37
65887061 NCBI36
2022 
CTCTCAGGTGCCCACAACTTCCCTG G → A CACCTTTTACCCTGGGTGGCTGAGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
134
66
1
0
0.007
136
68
0
0
0.000
134
67
0
0
0.000
132
66
0
0
0.000
n/a
0.000
PMT-272
Exon 12: 3UTR
66130477 GRCh37
65887053 NCBI36
2030 
TGTTCCTCCTCTCAGGTGCCCACAA C → T TTCCCTGGCACCTTTTACCCTGGGT
+ 
 
n=
C/C=
C/T=
T/T=
T=
134
67
0
0
0.000
136
66
2
0
0.015
134
67
0
0
0.000
132
65
1
0
0.008
n/a
0.000
PMT-272
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 12: 3UTR
66130367 GRCh37
65886943 NCBI36
2140 
GGGGCCCAGGCCCAGCTGGGCTCTG C → T GGAGTGGGTACAGTAAGTGTTGGCA
+ 
 
n=
C/C=
C/T=
T/T=
T=
134
65
2
0
0.015
136
68
0
0
0.000
134
67
0
0
0.000
132
66
0
0
0.000
n/a
0.000
PMT-272
Exon 12: 3UTR
66130358 GRCh37
65886934 NCBI36
2149 

T → A, G
TGTGGCCCTGGGGCCCAGGCCCAGC T → A GGGCTCTGCGGAGTGGGTACAGTAA
TGTGGCCCTGGGGCCCAGGCCCAGC T → G GGGCTCTGCGGAGTGGGTACAGTAA
+ 

 
 
 
n=
T/T=
T/A=
A/A=
T/G=
G/G=
A/G=
A=
G=
134
41
1
0
22
2
1
0.015
0.201
136
4
0
0
29
35
0
0.000
0.728
134
14
0
0
27
26
0
0.000
0.590
132
6
0
0
19
40
1
0.008
0.758
n/a
0.000
0.000
PMT-272
Exon 12: 3UTR
66130357 GRCh37
65886933 NCBI36
2150 
CTGTGGCCCTGGGGCCCAGGCCCAG C → T TGGGCTCTGCGGAGTGGGTACAGTA
+ 
 
n=
C/C=
C/T=
T/T=
T=
134
67
0
0
0.000
136
67
1
0
0.007
134
67
0
0
0.000
132
66
0
0
0.000
n/a
0.000
PMT-272
Exon 12: 3UTR
66130352 GRCh37
65886928 NCBI36
2155 
GCTAGCTGTGGCCCTGGGGCCCAGG C → T CCAGCTGGGCTCTGCGGAGTGGGTA
+ 
 
n=
C/C=
C/T=
T/T=
T=
134
65
2
0
0.015
136
68
0
0
0.000
134
67
0
0
0.000
132
66
0
0
0.000
n/a
0.000
PMT-272
Exon 12: 3UTR
66130297 GRCh37
65886873 NCBI36
2210 
AGAGAGTGGGTATGGAAGAGCTTTG C → T AAACTGTAAAGTGCAGTACACACAT
+ 
 
n=
C/C=
C/T=
T/T=
T=
134
65
2
0
0.015
136
68
0
0
0.000
134
67
0
0
0.000
132
66
0
0
0.000
n/a
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.