UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:ENT3
HGNC Symbol:SLC29A3
HGNC Description:solute carrier family 29 (equilibrative nucleoside transporter), member 3
HGNC ID:23096
Superfamily:SLC
Chromosome:Chr.10(+): 73079010-73123147 GRCh37
Location:10q22.1
OMIM:612373
OMIM Phenotype:None
Accessions:AY358686
Nucleotide RefSeq:NM_018344
Protein RefSeq:NP_060814
Entrez:55315
Ensembl:ENSG00000198246
Isoforms:2
Evidence:None
Tissues:None
Type:protein-coding
Sets:0
PharmGKB ID:PA134950750
HPRD ID:11570
Substrates:None
Trivial Names:ENT3, HJCD, PHID, HCLAP
Transcripts:NM_018344.5 [Chr.10(+): 73079010-73123147 GRCh37]
NM_001174098.1 [Chr.10(+): 73079010-73123147 GRCh37]
ENST00000373189 [Chr.10(+): 73079015-73123142 GRCh37]
ENST00000469204 [Chr.10(+): 73111445-73122276 GRCh37]
ENST00000479577 [Chr.10(+): 73079039-73082811 GRCh37]
Annotation History:View Events (2)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC29A3.

Variant Data

View all PMT variants for SLC29A3 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC29A3 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC29A3 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
73078657 GRCh37
72748663 NCBI36
-353-410
CGGCCTTTGGAGAGGGGTCTCTGCA G → C CGGCCTGGGGACAAGATGAGGGCTC
+ 
 
n=
G/G=
G/C=
C/C=
C=
130
64
1
0
0.008
108
54
0
0
0.000
130
65
0
0
0.000
130
65
0
0
0.000
PMT-272
 PDE
73078659 GRCh37
72748665 NCBI36
-351-408
GCCTTTGGAGAGGGGTCTCTGCAGC G → A GCCTGGGGACAAGATGAGGGCTCCT
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
62
3
0
0.023
108
46
7
1
0.083
130
65
0
0
0.000
130
62
3
0
0.023
PMT-272
 PDE
73078707 GRCh37
72748713 NCBI36
-303-360
CCTTTGAGTCCTGGGGTGCAGGTTA T → C AGTAGCTAAAGGGGAGGTCTGAGAC
+ 
 
n=
T/T=
T/C=
C/C=
C=
130
65
0
0
0.000
108
51
2
1
0.037
130
65
0
0
0.000
130
65
0
0
0.000
PMT-272
PromoterPDE
73078862 GRCh37
72748868 NCBI36
-148-205
CTTTTTCTCCTATAAAATGGGCGCA C → G GCAGGCCCCAGCTCAGCGCCAGAAG
+ 
 
n=
C/C=
C/G=
G/G=
G=
130
2
14
49
0.862
108
19
17
18
0.491
128
18
28
18
0.500
130
16
37
12
0.469
PMT-272
PromoterPDE
73078876 GRCh37
72748882 NCBI36
-134-191
AAATGGGCGCACGCAGGCCCCAGCT C → G AGCGCCAGAAGGGGGAGCCCCGGCG
+ 
 
n=
C/C=
C/G=
G/G=
G=
130
64
1
0
0.008
108
53
1
0
0.009
128
51
12
1
0.109
130
63
2
0
0.015
PMT-272
PromoterPDE
73078940 GRCh37
72748946 NCBI36
-70-127
CAAAGGAAAAAAGCGTGTTTGCAAA C → A GGGGAAGCGGCGGCGTGCTGCCGCG
+ 
 
n=
C/C=
C/A=
A/A=
A=
130
64
1
0
0.008
108
54
0
0
0.000
128
64
0
0
0.000
128
64
0
0
0.000
PMT-272
PromoterPDE
73078987 GRCh37
72748993 NCBI36
-23-80
CGCGAGGGGCGGGGCGGGGCCGGGG G → T AGGAGCCCGCCTGCCGCCTGCCAAG
+ 
 
n=
G/G=
G/T=
T/T=
T=
130
58
7
0
0.054
108
54
0
0
0.000
128
64
0
0
0.000
128
63
0
1
0.016
PMT-272
PromoterPDE
73078993 GRCh37
72748999 NCBI36
-17-74
GGGCGGGGCGGGGCCGGGGGAGGAG C → A CCGCCTGCCGCCTGCCAAGCCCAGT
+ 
 
n=
C/C=
C/A=
A/A=
A=
130
64
1
0
0.008
108
54
0
0
0.000
128
64
0
0
0.000
128
64
0
0
0.000
PMT-272
PromoterPDE
73079004 GRCh37
72749010 NCBI36
-6-63
GGCCGGGGGAGGAGCCCGCCTGCCG C → T CTGCCAAGCCCAGTGGTCCTGGCCG
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
41
23
1
0.192
108
35
10
9
0.259
128
63
1
0
0.008
128
48
16
0
0.125
PMT-272
 PDE
73079110 GRCh37
72749116 NCBI36
  
CGGGCTCTTCCGGCTACGGTCCCGG C → T CGCCCCCAGACTCGCGCTCAGCGAC
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
65
0
0
0.000
104
52
0
0
0.000
126
63
0
0
0.000
128
63
1
0
0.008
PMT-272
 PDE
73079126 GRCh37
72749132 NCBI36
  
CGGTCCCGGCCGCCCCCAGACTCGC G → A CTCAGCGACCTCCCTCCCGGACCCT
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
64
1
0
0.008
104
52
0
0
0.000
126
63
0
0
0.000
128
64
0
0
0.000
PMT-272
 PDE
73079147 GRCh37
72749153 NCBI36
  
TCGCGCTCAGCGACCTCCCTCCCGG A → G CCCTGGGGGCGGCTGCGGGCTGCCA
+ 
 
n=
A/A=
A/G=
G/G=
G=
130
28
30
7
0.338
100
17
13
20
0.530
124
15
25
22
0.556
128
8
35
21
0.602
PMT-272
 PDE
73079153 GRCh37
72749159 NCBI36
  
TCAGCGACCTCCCTCCCGGACCCTG G → T GGGCGGCTGCGGGCTGCCAGGGGAG
+ 
 
n=
G/G=
G/T=
T/T=
T=
130
64
1
0
0.008
100
50
0
0
0.000
124
62
0
0
0.000
128
63
0
1
0.016
PMT-272
Exon 6: CodingPDE
73121768 GRCh37
72791774 NCBI36
888831
TGTTTTCTGGTGAAGAGGAGCTTCC C → T CAGGACTCCCTCAGTGCCCCTTCGG
+277
Pro = Pro
n=
C/C=
C/T=
T/T=
T=
136
62
6
0
0.044
134
67
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
PMT-272
Exon 6: CodingPDE
73121779 GRCh37
72791785 NCBI36
899842
GAAGAGGAGCTTCCCCAGGACTCCC T → C CAGTGCCCCTTCGGTGGCCTCCAGA
+281
Leu → Pro
(D=98)
n=
T/T=
T/C=
C/C=
C=
136
62
6
0
0.044
134
67
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
PMT-272
Exon 6: CodingPDE
73121832 GRCh37
72791838 NCBI36
952895
CATTGATTCCCACACACCCCCTCTC C → T GCCCCATCCTGAAGAAGACGGCCAG
+299
Arg → Cys
(D=180)
n=
C/C=
C/T=
T/T=
T=
136
68
0
0
0.000
134
67
0
0
0.000
136
66
2
0
0.015
136
68
0
0
0.000
PMT-272
Exon 6: CodingPDE
73121883 GRCh37
72791889 NCBI36
1003946
CCTGGGCTTCTGTGTCACCTACGTC T → G TCTTCATCACCAGCCTCATCTACCC
+316
Phe → Val
(D=50)
n=
T/T=
T/G=
G/G=
G=
136
68
0
0
0.000
134
67
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
PMT-272
Exon 6: CodingPDEI
73121913 GRCh37
72791919 NCBI36
1033976
CATCACCAGCCTCATCTACCCCGCC A → G TCTGCACCAACATCGAGTCCCTCAA
+326
Ile → Val
(D=29)
n=
A/A=
A/G=
G/G=
G=
136
0
6
62
0.956
134
3
13
51
0.858
136
4
27
37
0.743
136
2
25
41
0.787
PMT-272
Exon 6: CodingPDE
73121938 GRCh37
72791944 NCBI36
10581001
ATCTGCACCAACATCGAGTCCCTCA A → G CAAGGGTTCGGGCTCACTGTGGACC
+334
Asn → Ser
(D=46)
n=
A/A=
A/G=
G/G=
G=
136
64
4
0
0.029
134
67
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 6: CodingPDEI
73121945 GRCh37
72791951 NCBI36
10651008
CCAACATCGAGTCCCTCAACAAGGG T → C TCGGGCTCACTGTGGACCACCAAGT
+336
Gly = Gly
n=
T/T=
T/C=
C/C=
C=
136
4
28
36
0.735
134
2
6
59
0.925
136
3
30
35
0.735
136
3
28
37
0.750
PMT-272
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
Exon 6: CodingPDE
73122083 GRCh37
72792089 NCBI36
12031146
CCAATAGCAAGGCGCTCCCAGGGTT C → T GTGCTCCTCCGGACCTGCCTCATCC
+382
Phe = Phe
n=
C/C=
C/T=
T/T=
T=
136
67
1
0
0.007
134
67
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 6: 3UTRPDEI
73122468 GRCh37
72792474 NCBI36
1588 
AGGAAAGGCCTAAAGTTTCACTTGG G → T GACAGAGAGCAGAGCACACTCGGGC
+ 
 
n=
G/G=
G/T=
T/T=
T=
136
48
19
1
0.154
136
52
16
0
0.118
136
55
11
2
0.110
136
49
18
1
0.147
PMT-272
Exon 6: 3UTRPDE
73122489 GRCh37
72792495 NCBI36
1609 
TTGGGGACAGAGAGCAGAGCACACT C → T GGGCCTCATCCCTCCCAAGATGCCA
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
PMT-272
Exon 6: 3UTRPDE
73122490 GRCh37
72792496 NCBI36
1610 
TGGGGACAGAGAGCAGAGCACACTC G → A GGCCTCATCCCTCCCAAGATGCCAG
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
68
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
PMT-272
Exon 6: 3UTRPDE
73122539 GRCh37
72792545 NCBI36
1659 
AGTGAGCCACGTCCATGCCCATTCC G → A TGCAAGGCAGATATTCCAGTCATAT
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
61
7
0
0.051
136
68
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
PMT-272
Exon 6: 3UTRPDE
73122618 GRCh37
72792624 NCBI36
1738 
AAGAAATAGCACAAATCAGGGGTAC T → G CCCTTCACAGCTGATGGTTAACATT
+ 
 
n=
T/T=
T/G=
G/G=
G=
136
68
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
PMT-272
Exon 6: 3UTRPDE
73122744 GRCh37
72792750 NCBI36
1864 
AGCCATGGGCTCTTTGCAACCTCCC A → G GCTGCGCTCATTCCAGCTGACAGCG
+ 
 
n=
A/A=
A/G=
G/G=
G=
136
65
3
0
0.022
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 6: 3UTRPDE
73122749 GRCh37
72792755 NCBI36
1869 
TGGGCTCTTTGCAACCTCCCAGCTG C → T GCTCATTCCAGCTGACAGCGAGATG
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
136
61
7
0
0.051
PMT-272
Exon 6: 3UTRPDE
73122794 GRCh37
72792800 NCBI36
1914 
GAGATGCAAGCAAATGCTCAGCTCT C → T CTTACCCTGAAGGGGTCTCCCTGGA
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 6: 3UTRPDE
73123022 GRCh37
72793028 NCBI36
2142 
ATGTCTGGCCTGGGTTTTCAAAAAA A → AA GAGGGATCCTCATGACCTGGTGGTC
+ 
 
n=
A/A=
A/AA=
AA/AA=
AA=
136
68
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 6: 3UTRPDE
73123070 GRCh37
72793076 NCBI36
2190 
GTCTATGGCCTGGGTCAAGATGAGG G → A TCTTTCAGTGTTCCTGTTTACAACA
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 6: 3UTRPDEI
73123076 GRCh37
72793082 NCBI36
2196 
GGCCTGGGTCAAGATGAGGGTCTTT C → T AGTGTTCCTGTTTACAACATGTCAA
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
60
8
0
0.059
136
68
0
0
0.000
136
65
3
0
0.022
136
67
1
0
0.007
PMT-272

Transmembrane prediction: TOPO2 image is not available.