UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:CTR1
HGNC Symbol:SLC31A1
HGNC Description:solute carrier family 31 (copper transporter), member 1
HGNC ID:11016
Superfamily:SLC
Chromosome:Chr.9(+): 115983808-116026772 GRCh37
Location:9q32
OMIM:603085
OMIM Phenotype:None
Accessions:U83460
Nucleotide RefSeq:NM_001859
Protein RefSeq:NP_001850
Entrez:1317
Ensembl:ENSG00000136868
Isoforms:1
Evidence:Substrate In Vitro Evidence: Copper, by expression in yeast Zhou and Gitschier 1997, PNAS, Vol 94, p.7481-7486 Copper in human fibroblasts Moller et al 2000, Gene, Vol 257 (1), p.13-22 Substrate In Vivo Evidence: CTR1 K.O. mouse is embryonic lethal. Heterozygoyes for the CTR1 gene have approximately half the copper in their brains vs. the CTR1 (+/+) littermates, but are phenotypically normal at 16 months Kuo et al 2001, PNAS, Vol 98 (12), p. 6836-41 Tissue Distribution Evidence: Present in all tissues examined by Northern Blot, highest expression in the liver, low expression in brain and skeletal muscle. Zhou and Gitschier 1997, PNAS, Vol 94, p.7481-7486
Tissues:ubiquitous mRNA, plasma and intracellular membranes
Type:protein-coding
Sets:I,IV
PharmGKB ID:PA118
HPRD ID:04362
Substrates:Copper (I)
Trivial Names:CTR1, COPT1
Transcripts:NM_001859.3 [Chr.9(+): 115983808-116026772 GRCh37]
ENST00000374210 [Chr.9(+): 115983808-116028674 GRCh37]
ENST00000374212 [Chr.9(+): 115983842-116026772 GRCh37]
ENST00000496650 [Chr.9(+): 115983867-115989940 GRCh37]
Annotation History:View Events (2)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC31A1.

Variant Data

View all PMT variants for SLC31A1 on UCSC Genome Browser
Showing SNP features for transcript: NM_001859  
SLC31A1 RESEQUENCING  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC31A1 RESEQUENCING
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 PDEI
115983540 GRCh37
115023361 NCBI36
-268-34889
ACCGAACATTGCGTTGGCTTTCACC G → A GGTTGCGGGGAGGAAGCTGGGTATT
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
49
16
1
0.136
136
51
16
1
0.132
134
32
28
7
0.313
128
52
11
1
0.102
n/a
0.000
PMT-272
PromoterPDE
115983660 GRCh37
115023481 NCBI36
-148-34769
GCGAACTCCAGCACGGTCTCTGGAC C → T GAAAGTAGACTGGGCTCTGGAGAAG
+ 
 
n=
C/C=
C/T=
T/T=
T=
132
65
1
0
0.008
136
67
1
0
0.007
134
67
0
0
0.000
128
64
0
0
0.000
n/a
0.000
PMT-272
PromoterPDE
115983760 GRCh37
115023581 NCBI36
-48-34669
CGTCAGGCCTCTCCAGCCCGCAGCG G → T GGCGGAGCTTCACAGCCCCTTGCAG
+ 
 
n=
G/G=
G/T=
T/T=
T=
132
66
0
0
0.000
136
68
0
0
0.000
134
64
3
0
0.022
128
64
0
0
0.000
n/a
0.000
PMT-272
PromoterPDE
115983793 GRCh37
115023614 NCBI36
-15-34636
CTTCACAGCCCCTTGCAGGGATTGG T → TAGGGGGCGGG CGGTAATGCTAGGGGGCGGGAGGGG
+ 
 
n=
T/T=
T/TAGGGGGCGGG=
TAGGGGGCGGG/TAGGGGGCGGG=
TAGGGGGCGGG=
132
66
0
0
0.000
136
65
3
0
0.022
134
67
0
0
0.000
128
62
2
0
0.016
n/a
0.000
PMT-272
Exon 2: CodingPDE
116018501 GRCh37
115058322 NCBI36
25973
TACCATGCAACCTTCTCACCATCAC C → G CAACCACTTCAGCCTCACACTCCCA
+25
Pro → Ala
(D=27)
n=
C/C=
C/G=
G/G=
G=
200
86
13
1
0.075
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.