UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:VGAT
HGNC Symbol:SLC32A1
HGNC Description:solute carrier family 32 (GABA vesicular transporter), member 1
HGNC ID:11018
Superfamily:SLC
Chromosome:Chr.20(+): 37353105-37358015 GRCh37
Location:20q11.23
OMIM:
OMIM Phenotype:None
Accessions:NM_080552.1
Nucleotide RefSeq:NM_080552
Protein RefSeq:NP_542119
Entrez:140679
Ensembl:ENSG00000101438
Isoforms:1
Evidence:None
Tissues:None
Type:protein-coding
Sets:II,IV
PharmGKB ID:PA401
HPRD ID:18058
Substrates:None
Trivial Names:VGAT, VIAAT
Transcripts:NM_080552.2 [Chr.20(+): 37353105-37358015 GRCh37]
ENST00000217420 [Chr.20(+): 37353105-37358015 GRCh37]

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC32A1.

Variant Data

View all PMT variants for SLC32A1 on UCSC Genome Browser
Showing SNP features for transcript: NM_080552  
SLC32A1 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC32A1 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
37352663 GRCh37
36786077 NCBI36
-442-705
ATCTGGGGCTGCACAGCTCCCGGAC C → T CTGGAGGGGGTGGTCCGGGGGTGGG
+ 
 
n=
C/C=
C/T=
T/T=
T=
132
63
3
0
0.023
136
68
0
0
0.000
126
63
0
0
0.000
134
67
0
0
0.000
PMT-272
 PDE
37352759 GRCh37
36786173 NCBI36
-346-609
GGCGAGGTGGGAAGGGCCAGGATGC G → C AGCTTAGCACCTCCCCTAGAAATGC
+ 
 
n=
G/G=
G/C=
C/C=
C=
132
59
6
1
0.061
136
63
5
0
0.037
126
63
0
0
0.000
134
65
2
0
0.015
PMT-272
 PDEI
37352849 GRCh37
36786263 NCBI36
-256-519
CTCTTTCACGCGCTCCCTCCCGCCT C → T CTTCCCAAGGGCGCCCTTCTTCTGC
+ 
 
n=
C/C=
C/T=
T/T=
T=
132
47
16
3
0.167
136
15
32
21
0.544
126
19
30
14
0.460
134
14
36
17
0.522
PMT-272
PromoterPDE
37352869 GRCh37
36786283 NCBI36
-236-499
CGCCTCCTTCCCAAGGGCGCCCTTC T → C TCTGCCCCCAGCTCACGTCTGAATC
+ 
 
n=
T/T=
T/C=
C/C=
C=
132
59
7
0
0.053
136
68
0
0
0.000
126
63
0
0
0.000
134
67
0
0
0.000
PMT-272
PromoterPDE
37352871 GRCh37
36786285 NCBI36
-234-497
CCTCCTTCCCAAGGGCGCCCTTCTT C → T TGCCCCCAGCTCACGTCTGAATCCC
+ 
 
n=
C/C=
C/T=
T/T=
T=
132
66
0
0
0.000
136
67
1
0
0.007
126
63
0
0
0.000
134
67
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.