UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:4F2
HGNC Symbol:SLC3A2
HGNC Description:solute carrier family 3 (amino acid transporter heavy chain), member 2
HGNC ID:11026
Superfamily:SLC
Chromosome:Chr.11(+): 62623484-62656355 GRCh37
Location:11q13
OMIM:158070
OMIM Phenotype:None
Accessions:NM_002394
Nucleotide RefSeq:NM_001012661
Protein RefSeq:NP_001012679
Entrez:6520
Ensembl:ENSG00000168003
Isoforms:4
Evidence:Substrate In Vitro Evidence: SLC3A2 (4F2hc) is the "heavy chain" of several heterodimeric amino acid transporters (HATs), which is necessary for proper insertion of the heterodimer partner ("light chain"), considered the catalytic subunit, into the plasma membrane. The heterodimer partners of SLC3A2 are several members of the SLC7 family (see SLC7A6-10). The substrate specificity of these dimers varies with the identity of the SLC7 family subunit. Substrate In Vivo Evidence: SLC3A2 has not been directly associated with any human disease; however, several SLC7 family members, which require SLC3A2 for activity, have been associated with diseases of amino acid hyperexcretion (see SLC7A6-10). Tissue Distribution Evidence: Northern blot analysis in mice demonstrated that the 4F2hc gene is expressed at relatively high levels in adult testis, lung, brain, kidney, and spleen, and at significantly lower levels in adult liver and cardiac and skeletal muscle (Parmacek MS, Karpinski BA, Gottesdiener KM, Thompson CB, Leiden JM. Structure, expression and regulation of the murine 4F2 heavy chain. Nucleic Acids Res 17(5): 1915-31, 1989).
Tissues:Mice: testis, lung, brain, kidney, spleen (high); liver, cardiac muscle, skeletal muscle (low)
Type:protein-coding
Sets:IV
PharmGKB ID:PA35894
HPRD ID:01148
Substrates:See SLC7
Trivial Names:4F2, CD98, MDU1, 4F2HC, 4T2HC, NACAE, CD98HC
Transcripts:NM_001012662.2 [Chr.11(+): 62623484-62656355 GRCh37]
NM_001012664.2 [Chr.11(+): 62623484-62656355 GRCh37]
NM_001013251.2 [Chr.11(+): 62648344-62656355 GRCh37]
NM_002394.5 [Chr.11(+): 62623484-62656355 GRCh37]
ENST00000338663 [Chr.11(+): 62648344-62656327 GRCh37]
ENST00000377889 [Chr.11(+): 62623616-62656325 GRCh37]
ENST00000377890 [Chr.11(+): 62623574-62656265 GRCh37]
ENST00000377891 [Chr.11(+): 62623583-62656332 GRCh37]
ENST00000377892 [Chr.11(+): 62623518-62656352 GRCh37]
ENST00000457660 [Chr.11(+): 62649277-62653998 GRCh37]
ENST00000535296 [Chr.11(+): 62623640-62656347 GRCh37]
ENST00000535768 [Chr.11(+): 62651927-62655641 GRCh37]
ENST00000536981 [Chr.11(+): 62649197-62656317 GRCh37]
ENST00000537508 [Chr.11(+): 62649140-62652786 GRCh37]
ENST00000537839 [Chr.11(+): 62649171-62651470 GRCh37]
ENST00000538084 [Chr.11(+): 62638286-62649466 GRCh37]
ENST00000538682 [Chr.11(+): 62649181-62655927 GRCh37]
ENST00000539458 [Chr.11(+): 62648368-62649509 GRCh37]
ENST00000539507 [Chr.11(+): 62652649-62656332 GRCh37]
ENST00000539891 [Chr.11(+): 62649171-62655840 GRCh37]
ENST00000541372 [Chr.11(+): 62648368-62648762 GRCh37]
ENST00000541425 [Chr.11(+): 62650433-62653059 GRCh37]
ENST00000541649 [Chr.11(+): 62649170-62649858 GRCh37]
ENST00000542793 [Chr.11(+): 62655342-62655992 GRCh37]
ENST00000542922 [Chr.11(+): 62650820-62656330 GRCh37]
ENST00000544377 [Chr.11(+): 62647894-62648900 GRCh37]
ENST00000546253 [Chr.11(+): 62649194-62651984 GRCh37]
ENST00000546312 [Chr.11(+): 62650247-62652859 GRCh37]
Annotation History:View Events (21)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC3A2.

Variant Data

Showing SNP features for transcript:   
SLC3A2 RESEQUENCING  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC3A2 RESEQUENCING
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
62623294 GRCh37
62379870 NCBI36
n/an/a
AAAAGAAAATAAAAGAAAAAGACAA A → AA GTACAAAAGAGTAACAGCTATAAAG
n/a
 
n=
A/A=
A/AA=
AA/AA=
AA=
132
66
0
0
0.000
124
62
0
0
0.000
128
64
0
0
0.000
126
62
1
0
0.008
PMT-272
 PDE
62623497 GRCh37
62380073 NCBI36
n/an/a
TTGTGGGTAGAGAGTTCCAGGGAAG G → C AGGGCGTAGACAAAGCGCCACCTGA
n/a
 
n=
G/G=
G/C=
C/C=
C=
132
65
1
0
0.008
124
62
0
0
0.000
128
64
0
0
0.000
124
62
0
0
0.000
PMT-272
 PDE
62623581 GRCh37
62380157 NCBI36
n/an/a
ACGGGAGCGTGCTGGCTCACCGACC G → A CATTGCGGCTTGGTTTTCTCACCCA
n/a
 
n=
G/G=
G/A=
A/A=
A=
132
66
0
0
0.000
124
61
1
0
0.008
128
64
0
0
0.000
124
62
0
0
0.000
PMT-272

Transmembrane prediction: TOPO2 image is not available.