UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:IREG1
HGNC Symbol:SLC40A1
HGNC Description:solute carrier family 40 (iron-regulated transporter), member 1
HGNC ID:10909
Superfamily:SLC
Chromosome:Chr.2(-): 190425316-190448478 GRCh37
Location:2q32
OMIM:604653
OMIM Phenotype:Hemochromatosis, type 4
Accessions:NM_014585.1
Nucleotide RefSeq:NM_014585
Protein RefSeq:NP_055400
Entrez:30061
Ensembl:ENSG00000138449
Isoforms:3
Evidence:Substrate In Vitro Evidence: 1. Ferrous iron - Xenopus Oocytes - McKie AT et al, Molecular Cell 2000: 299-309 2. Ferrous iron - villus enterocytes, IEC-6 - Thomas C et al, Gut 2004: 44-49 Substrate In Vivo Evidence: 1. IREG1 isolated from duodenal mucosa of hpx/hpx (hypotransferrinemic) mouse Tissue Distribution Evidence: 1. Duodenal mucusa - Northern Blot - McKie AT et al, Molecular Cell 2000: 299-309 2. Spleen, liver, Kidney, Placenta - Northern - Donovan A et al, Nature 2000: 776-781
Tissues:duodenal mucosa, spleen, liver, kidney, placenta
Type:protein-coding
Sets:I
PharmGKB ID:PA35805
HPRD ID:05229
Substrates:FERROUS IRION
Trivial Names:FPN1, HFE4, MTP1, IREG1, MST079, MSTP079, SLC11A3
Transcripts:NM_014585.5 [Chr.2(-): 190425316-190445537 GRCh37]
XM_005246504.1 [Chr.2(-): 190425316-190448478 GRCh37]
XM_005246505.1 [Chr.2(-): 190425316-190445537 GRCh37]
ENST00000261024 [Chr.2(-): 190425305-190445613 GRCh37]
ENST00000418714 [Chr.2(-): 190439887-190445509 GRCh37]
ENST00000427241 [Chr.2(-): 190430239-190448484 GRCh37]
ENST00000427419 [Chr.2(-): 190444574-190446748 GRCh37]
ENST00000440626 [Chr.2(-): 190444574-190448128 GRCh37]
ENST00000455320 [Chr.2(-): 190439992-190446757 GRCh37]
ENST00000479598 [Chr.2(-): 190437247-190445467 GRCh37]
Annotation History:View Events (18)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC40A1.

Variant Data

View all PMT variants for SLC40A1 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC40A1 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC40A1 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 1: 5UTRPDE1 pubA
190445194 GRCh37
190153439 NCBI36
344-8
GCCGCAGAAGAGCCAGCGGGGTCGC C → G TAGTGTCATGACCAGGGCGGGAGAT
- 
 
n=
C/C=
C/G=
G/G=
G=
200
94
6
0
0.030
200
68
25
7
0.195
60
27
3
0
0.050
20
9
1
0
0.050
14
6
1
0
0.071
Set-I
 
190445127 GRCh37
190153372 NCBI36
  
GATGCTGTGGTGAGTGTCGTTGACC G → GG AAAGCATATGGTGGAAACCCAGGTG
- 
 
n=
G/G=
G/GG=
GG/GG=
GG=
200
100
0
0
0.000
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE1 pubA
190444630 GRCh37
190152875 NCBI36
  
CATTAAGTGACTACCATCGCTTTTT G → C TCACCCCGCCTGTGTCTTTGCAGGA
- 
 
n=
G/G=
G/C=
C/C=
C=
200
44
46
10
0.330
198
4
21
74
0.854
58
0
12
17
0.793
20
1
3
6
0.750
14
0
5
2
0.643
Set-I
 PDE
190439877 GRCh37
190148122 NCBI36
  
AATGCTAGACTTAAAGGTGAGTGTT G → - TTATATAATTAAGCCCTTTTATTCA
- 
 
n=
G/G=
G/-=
-/-=
-=
200
100
0
0
0.000
200
100
0
0
0.000
60
29
1
0
0.017
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
190439876 GRCh37
190148121 NCBI36
  
ATGCTAGACTTAAAGGTGAGTGTTG T → - TATATAATTAAGCCCTTTTATTCAT
- 
 
n=
T/T=
T/-=
-/-=
-=
200
100
0
0
0.000
200
100
0
0
0.000
60
29
1
0
0.017
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
190439875 GRCh37
190148120 NCBI36
  
TGCTAGACTTAAAGGTGAGTGTTGT T → - ATATAATTAAGCCCTTTTATTCATG
- 
 
n=
T/T=
T/-=
-/-=
-=
200
100
0
0
0.000
200
100
0
0
0.000
60
29
1
0
0.017
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 4: CodingPDE2 pubsI
190437632 GRCh37
190145877 NCBI36
678327
TTTCAGTCATCCTGTGTGGAATCAT C → T CTGATGATGGTTTTCTTACATAAAC
-109
Ile = Ile
n=
C/C=
C/T=
T/T=
T=
200
88
12
0
0.060
200
100
0
0
0.000
60
30
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
Exon 4: CodingPDE2 pubsI
190437572 GRCh37
190145817 NCBI36
738387
TGACCATGTACCATGGATGGGTTCT C → T GTAAGTTCTCAATGAGATTCTTGAT
-129
Leu = Leu
n=
C/C=
C/T=
T/T=
T=
200
78
21
1
0.115
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 6: CodingPDE4 pubsIA
190430177 GRCh37
190138422 NCBI36
1014663
TGGTATCCATGTGCGTGGAGTACGT T → C CTGCTCTGGAAGGTTTACCAGAAAA
-221
Val = Val
n=
T/T=
T/C=
C/C=
C=
200
94
6
0
0.030
200
83
8
9
0.130
60
25
0
5
0.167
20
9
0
1
0.100
14
5
2
0
0.143
Set-I
Exon 6: CodingPDE7 pubsIA
190430096 GRCh37
190138341 NCBI36
1095744
AAGAAGAGGAAACTGAATTGAAACA G → T CTGAATTTACACAAAGGTAAACTGA
-248
Gln → His
(D=24)
n=
G/G=
G/T=
T/T=
T=
200
84
16
0
0.080
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 7: CodingPDEI
190428418 GRCh37
190136663 NCBI36
16451294
ACCTGAAATTACAACTGAAATATAC A → G TGTCTAATGGGTCTAATTCTGCTAA
-432
Met → Val
(D=21)
n=
A/A=
A/G=
G/G=
G=
200
97
3
0
0.015
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 7: CodingPDE
190428384 GRCh37
190136629 NCBI36
16791328
GGGTCTAATTCTGCTAATATTGTCC C → T GGAGACAAGTCCTGAATCTGTGCCC
-443
Pro → Leu
(D=98)
n=
C/C=
C/T=
T/T=
T=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
190428284 GRCh37
190136529 NCBI36
  
GTAAGAAATCTCTTTTTATATATTA A → G TGAACTAAAGTGTCTTTTTGTAATG
- 
 
n=
A/A=
A/G=
G/G=
G=
200
97
3
0
0.015
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 8: CodingPDE2 pubsI
190426639 GRCh37
190134884 NCBI36
20321681
TTGCGGTCCTGATGCAAAAGAAGTT A → G GGAAGGAAAATCAAGCAAATACATC
-561
Arg → Gly
(D=125)
n=
A/A=
A/G=
G/G=
G=
200
97
3
0
0.015
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.