UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:MATE1
HGNC Symbol:SLC47A1
HGNC Description:solute carrier family 47 (multidrug and toxin extrusion), member 1
HGNC ID:25588
Superfamily:SLC
Chromosome:Chr.17(+): 19437167-19482346 GRCh37
Location:17p11.2
OMIM:609832
OMIM Phenotype:None
Accessions:None
Nucleotide RefSeq:NM_018242
Protein RefSeq:NP_060712
Entrez:55244
Ensembl:ENSG00000142494
Isoforms:6
Evidence:None
Tissues:None
Type:protein-coding
Sets:None
PharmGKB ID:PA162403808
HPRD ID:07703
Substrates:None
Trivial Names:MATE1
Transcripts:NM_018242.2 [Chr.17(+): 19437167-19482346 GRCh37]
XM_005256710.1 [Chr.17(+): 19437167-19481665 GRCh37]
XM_005256711.1 [Chr.17(+): 19437167-19481246 GRCh37]
XM_005256714.1 [Chr.17(+): 19437167-19480765 GRCh37]
XM_005256712.1 [Chr.17(+): 19437167-19480731 GRCh37]
XM_005256713.1 [Chr.17(+): 19437189-19480924 GRCh37]
ENST00000270570 [Chr.17(+): 19437167-19482347 GRCh37]
ENST00000395585 [Chr.17(+): 19437193-19482219 GRCh37]
ENST00000436810 [Chr.17(+): 19437141-19480924 GRCh37]
ENST00000457293 [Chr.17(+): 19437167-19481427 GRCh37]
ENST00000495425 [Chr.17(+): 19458822-19480953 GRCh37]
ENST00000497548 [Chr.17(+): 19437191-19482219 GRCh37]
ENST00000542886 [Chr.17(+): 19437167-19463565 GRCh37]
ENST00000571335 [Chr.17(+): 19436775-19480910 GRCh37]
ENST00000573009 [Chr.17(+): 19459145-19481142 GRCh37]
ENST00000574596 [Chr.17(+): 19437173-19438927 GRCh37]
ENST00000575023 [Chr.17(+): 19437189-19482219 GRCh37]
ENST00000575362 [Chr.17(+): 19470452-19471397 GRCh37]
ENST00000575377 [Chr.17(+): 19458886-19481250 GRCh37]
ENST00000576095 [Chr.17(+): 19437189-19451417 GRCh37]
ENST00000581558 [Chr.17(+): 19476110-19482217 GRCh37]
ENST00000584348 [Chr.17(+): 19398698-19458622 GRCh37]
Annotation History:View Events (44)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC47A1.

Variant Data

View all PMT variants for SLC47A1 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC47A1 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC47A1 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
19436706 GRCh37
19377298 NCBI36
-461-547
TCTAATGGAACAACTGATGAGAGGA G → C AGGAGTATGCAACACCCTAACCAGC
+ 
 
n=
G/G=
G/C=
C/C=
C=
130
65
0
0
0.000
132
63
3
0
0.023
132
66
0
0
0.000
132
66
0
0
0.000
PMT-272
 PDE
19436806 GRCh37
19377398 NCBI36
-361-447
ACACACCCCGCGGGGTGCTAACCGA G → A TCACGGCTCGAGGCCTCTGGGTCCT
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
66
0
0
0.000
134
66
1
0
0.007
132
66
0
0
0.000
132
66
0
0
0.000
PMT-272
PromoterPDE
19437044 GRCh37
19377636 NCBI36
-123-209
GGTGCAGAGAGAGGTGCAAGGGGCG C → A GCCCAAGGTCGCAGGCTGCCTGGCT
+ 
 
n=
C/C=
C/A=
A/A=
A=
132
65
1
0
0.008
134
67
0
0
0.000
132
66
0
0
0.000
132
66
0
0
0.000
PMT-272
PromoterPDE
19437050 GRCh37
19377642 NCBI36
-117-203
GAGAGAGGTGCAAGGGGCGCGCCCA A → C GGTCGCAGGCTGCCTGGCTGCGCGC
+ 
 
C=
0.000
0.000
0.007
0.000
PMT-272
PromoterPDE
19437141 GRCh37
19377733 NCBI36
-26-112
GGCGGGCGGCCGGGGCGGGGACTGC AGAGCAGGC → - TGCACTGCGCGGTACCC
+ 
 
n=
AGAGCAGGC/AGAGCAGGC=
AGAGCAGGC/-=
-/-=
-=
132
66
0
0
0.000
134
67
0
0
0.000
132
66
0
0
0.000
132
65
1
0
0.008
PMT-272
Promoter
Exon 1: 5UTR
PDE3 pubs
19437187 GRCh37
19377779 NCBI36
21-66
TACCCACTGCCGGCCTGCGCGGTAC T → C CACTGCCGGCCTCCGCGGTACCCAC
Haplotypes containing the variant showed decreased luciferase activity in reporter assays in cells and in vivo assay. PMID: 19940846.
+ 
 
n=
T/T=
T/C=
C/C=
C=
128
17
37
10
0.445
134
30
31
6
0.321
130
38
24
3
0.231
128
32
27
5
0.289
PMT-272
Promoter
Exon 1: 5UTR
PDE
19437200 GRCh37
19377792 NCBI36
34-53
CCTGCGCGGTACTCACTGCCGGCCT C → G CGCGGTACCCACTGCCGGCCTCCGC
+ 
 
n=
C/C=
C/G=
G/G=
G=
120
58
2
0
0.017
130
58
7
0
0.054
130
61
4
0
0.031
128
56
6
2
0.078
PMT-272
Promoter
Exon 1: 5UTR
PDE
19437205 GRCh37
19377797 NCBI36
39-48
GCGGTACTCACTGCCGGCCTCCGCG GTACCCACTGCCGGCCTCCGCG → - CTAC
+ 
 
n=
GTACCCACTGCCGGCCTCCGCG/GTACCCACTGCCGGCCTCCGCG=
GTACCCACTGCCGGCCTCCGCG/-=
-/-=
-=
120
57
3
0
0.025
130
65
0
0
0.000
126
63
0
0
0.000
128
64
0
0
0.000
PMT-272
Promoter
Exon 1: 5UTR
PDE
19437209 GRCh37
19377801 NCBI36
43-44
TACTCACTGCCGGCCTCCGCGGTAC C → T CACTGCCGGCCTCCGCGCTACCCGG
+ 
 
T=
0.015
0.015
0.029
0.008
PMT-272
Exon 1: 5UTRPDE
19437226 GRCh37
19377818 NCBI36
60-27
CGCGGTACCCACTGCCGGCCTCCGC G → GGTACCCACTGCCGGCCTCCGCG CTACCCGGCCGCAGCGCGCGAGTCA
+ 
 
GGTACCCACTGCCGGCCTCCGCG=
0.037
0.059
0.044
0.068
PMT-272
Exon 1: CodingPDE
19437339 GRCh37
19377931 NCBI36
17387
GTGGGTCGCGCTGCTTGCGGCTGTC C → T GCCTTCCGAGAAGAGCTGCGGGCGC
+29
Ser = Ser
T=
0.000
0.022
0.000
0.007
PMT-272
 PDE
19437401 GRCh37
19377993 NCBI36
  
GCTGGCCCCGCGGTGAGTAAGGTGG C → A CTCAGTGGCAGGCCGGTACCGGCGG
+ 
 
A=
0.000
0.000
0.000
0.022
PMT-272
 PDE
19437456 GRCh37
19378048 NCBI36
  
GGGACCTGGTGATTTCTGCCTCCGC G → A GGTGACTTTGGCGGGCTTTGGGGAC
+ 
 
A=
0.000
0.000
0.000
0.007
PMT-272
 PDE
19437598 GRCh37
19378190 NCBI36
  
CCGCTCCGCACCACCCGACTGGGGG C → A CCCGCGGGGCACTGCGGGAACGGCT
+ 
 
A=
0.000
0.044
0.000
0.000
PMT-272
 PDE
19437635 GRCh37
19378227 NCBI36
  
CTGCGGGAACGGCTGGTACGCGCCC G → A GGCGCATGTTGGCTCGGAGAGGCCG
+ 
 
A=
0.015
0.000
0.000
0.000
PMT-272
 PDE
19445661 GRCh37
19386253 NCBI36
  
ACACTTGGGGCCCCAGGCTTCCCTG C → A AATGGTGGTCACTCACGTCCCTTCC
+ 
 
A=
0.000
0.000
0.000
0.015
PMT-272
 PDE
19445669 GRCh37
19386261 NCBI36
  
GGCCCCAGGCTTCCCTGCAATGGTG G → T TCACTCACGTCCCTTCCCGTTCCCC
+ 
 
T=
0.022
0.000
0.000
0.000
PMT-272
Exon 2: CodingPDE3 pubs
19445761 GRCh37
19386353 NCBI36
277191
AGCTTCATAAGCTCCGTGTTCTGTG G → A CCACCTGGGCAAGCTGGAGCTGGAT
Reduced uptake of metformin, paraquat and oxaliplatin in transfected cells. PMID: 19940846.
+64
Gly → Asp
(D=94)
A=
0.000
0.000
0.007
0.000
PMT-272
 PDE
19445826 GRCh37
19386418 NCBI36
  
AATCGCGGTACGTGTGGGCTTTCTG G → T CAGGTTTACCAACACTGTCTGTGTT
+ 
 
T=
0.015
0.000
0.000
0.000
PMT-272
Exon 3: CodingPDE
19449780 GRCh37
19390372 NCBI36
356270
ATGTCACTGGTGTCTCAGTGGGATT C → T GGCTTATCTTCTGCCTGTGACACCC
+90
Phe = Phe
T=
0.051
0.000
0.000
0.000
PMT-272
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
Exon 4: CodingPDE3 pubs
19451364 GRCh37
19391956 NCBI36
459373
GCAGCGGAGTGCGCTCGTCCTGCTC C → T TCTGCTGCTTCCCCTGCTGGGCGCT
Altered uptake transport for oxaliplatin, metformin and paraquat in transfected cells. PMID: 19940846.
+125
Leu → Phe
(D=22)
T=
0.000
0.000
0.007
0.051
PMT-272
 PDE
19454725 GRCh37
19395317 NCBI36
  
TGAAACATTAACATTCATCTCTCTT G → C TTCTCTTGTAGGCAACCTTTCTTTA
+ 
 
C=
0.118
0.213
0.272
0.081
PMT-272
 PDE
19454733 GRCh37
19395325 NCBI36
  
TAACATTCATCTCTCTTGTTCTCTT G → A TAGGCAACCTTTCTTTATATGTTAC
+ 
 
A=
0.162
0.213
0.375
0.199
PMT-272
Exon 8: CodingPDEA
19458972 GRCh37
19399564 NCBI36
794708
CTCTACTCCTCTTTCTCTACATCCT C → T GGGAAAAAACTGCATCAAGCTACAT
+236
Leu = Leu
T=
0.007
0.000
0.083
0.076
PMT-272
 PDE
19459238 GRCh37
19399830 NCBI36
  
TTCCTCAGTGGTCTGTATGAGGATG G → A ATGACGGGGACTGGTGGGAACCTGG
+ 
 
A=
0.023
0.000
0.000
0.000
PMT-272
Exon 10: CodingPDE
19459345 GRCh37
19399937 NCBI36
977891
TGGTGGAGCTGGGCGCTCAGTCCAT C → T GTGTATGAACTGGCCATCATTGTGT
+297
Ile = Ile
T=
0.008
0.000
0.000
0.000
PMT-272
Exon 11: CodingPDE3 pubs
19463591 GRCh37
19404183 NCBI36
10981012
GGAGCAGGCACGGAAGTCCTCTACC G → A TTTCCCTGCTGATTACAGGTGCTGA
Altered uptake transport for oxaliplatin, metformin and paraquat in transfected cells. PMID: 19940846.
+338
Val → Ile
(D=29)
A=
0.051
0.000
0.000
0.000
PMT-272
 PDEI
19463685 GRCh37
19404277 NCBI36
  
ACCCAGGCTCCTCCACTTCCTGTGG A → G TCTTCTTGTTCACTGTGTTGTTTCT
+ 
 
G=
0.272
0.000
0.000
0.007
PMT-272
 PDE
19470368 GRCh37
19410960 NCBI36
  
CGGGAGATGGGAGTGTTTCAAGAGC G → C CCGGATGTGTTCACAGTGATGGAAT
+ 
 
C=
0.000
0.000
0.007
0.000
PMT-272
Exon 15: CodingPDE
19474875 GRCh37
19415467 NCBI36
14801394
ATTATTCAGCTAAATTGGAAAAAAG C → T CTGTCAGCAGGTAACTATGTTCATT
+465
Ala → Val
(D=64)
T=
0.000
0.007
0.000
0.000
PMT-272
Exon 16: CodingPDE2 pubs
19476126 GRCh37
19416718 NCBI36
15241438
ACACGCCAATTTGAAAGTAAACAAC G → A TGCCTCGGAGTGGGAATTCTGCTCT
Reduced uptake of metformin, paraquat and oxaliplatin in transfected cells. PMID: 19940846.
+480
Val → Met
(D=21)
A=
0.000
0.000
0.008
0.000
PMT-272
 PDE
19476188 GRCh37
19416780 NCBI36
  
CGCTTCACCCAGGTAAGATATGACT C → A CCTCAGCCCTTGGACAGGCCTGTCT
+ 
 
A=
0.000
0.000
0.000
0.007
PMT-272
 PDE
19480620 GRCh37
19421212 NCBI36
  
AAAAAAAAATCCCTTTTAAGCTGCT A → G AGTTCCTTTTTCCTCCCAGGGTGCC
+ 
 
G=
0.024
0.000
0.000
0.000
PMT-272
Exon 17: CodingPDE1 pub
19480643 GRCh37
19421235 NCBI36
15761490
CTAAGTTCCTTTTTCCTCCCAGGGT G → T CCCTGAAAACCTTGAAGGAATTTTA
+497
Cys → Phe
(D=205)
T=
0.024
0.000
0.000
0.000
PMT-272
Exon 17: CodingPDE
19480710 GRCh37
19421302 NCBI36
16431557
AGACAGGCGAGCCTCAGTCAGATCA G → C CAGATGCGCCAAGAAGAACCTTTGC
+519
Gln → His
(D=24)
C=
0.008
0.000
0.000
0.000
PMT-272
Exon 17: 3UTRPDE
19480929 GRCh37
19421521 NCBI36
1862 
GAGCTTACACACAATTCACAGGCCC A → G CCAGTGACAATTTACTGTGAGTTAA
+ 
 
n=
A/A=
A/G=
G/G=
G=
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
PMT-272
Exon 17: 3UTRPDE
19480995 GRCh37
19421587 NCBI36
1928 
CCCATGGATTTTGAGGGCTGGAAAT G → A CAAAGACACATTTTTCTATAAAAAG
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
66
2
0
0.015
136
68
0
0
0.000
136
68
0
0
0.000
136
66
2
0
0.015
PMT-272
Exon 17: 3UTRPDE
19481161 GRCh37
19421753 NCBI36
2094 
GGCCAATGGCTTTGATACTTCTGCT A → G TTTTTTTAGACACAAACCCATAAAC
+ 
 
n=
A/A=
A/G=
G/G=
G=
136
40
24
4
0.235
136
68
0
0
0.000
136
68
0
0
0.000
136
65
3
0
0.022
PMT-272
Exon 17: 3UTRPDE
19481195 GRCh37
19421787 NCBI36
2128 
GACACAAACCCATAAACTAACTGCT T → G AAGAATTCATACTGCTTGAATTATG
+ 
 
n=
T/T=
T/G=
G/G=
G=
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
PMT-272
Exon 17: 3UTRPDE
19481284 GRCh37
19421876 NCBI36
2217 
GATTACTATTCACTGGGCAAATGGT A → G TTTGTTTTTGTTTTAATTTTTTTTT
+ 
 
n=
A/A=
A/G=
G/G=
G=
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
Exon 17: 3UTRPDE
19481335 GRCh37
19421927 NCBI36
2268 
TAATAGACGGAAGTCTTGCTCTGTC A → C TGCAGGCTGGAGTGCGGTGGTGCGA
+ 
 
n=
A/A=
A/C=
C/C=
C=
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 17: 3UTR
19481553 GRCh37
19422145 NCBI36
2486 
ATCTTTCGAGCTGTGGAAATCCAAA CAAA → - GACTGATAATTCCTGGTAGGGG
+ 
 
n=
CAAA/CAAA=
CAAA/-=
-/-=
-=
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
PMT-272
Exon 17: 3UTRPDE
19481601 GRCh37
19422193 NCBI36
2534 
GGGTGTGTGCGTGACGTACTGCAGC C → G TCAACCTCCTGGGCTCAAGTGATCC
+ 
 
n=
C/C=
C/G=
G/G=
G=
136
66
2
0
0.015
136
68
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
Exon 17: 3UTRPDE
19481664 GRCh37
19422256 NCBI36
2597 
CTCCTGAGTAGCTGAGACCACAGGC G → A TGTGCCACCACGCCTAGCTAATTTT
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
58
10
0
0.074
136
43
21
4
0.213
136
41
23
4
0.228
134
51
14
2
0.134
PMT-272
Exon 17: 3UTRPDE
19481762 GRCh37
19422354 NCBI36
2695 
GGGATCAAGCAATCCTTCCACCTTG C → A CCTCCCAAAGTGTTGGGATTATAGG
+ 
 
n=
C/C=
C/A=
A/A=
A=
136
53
15
0
0.110
136
68
0
0
0.000
136
68
0
0
0.000
134
66
1
0
0.007
PMT-272
Exon 17: 3UTRPDE
19481769 GRCh37
19422361 NCBI36
2702 
AGCAATCCTTCCACCTTGCCCTCCC A → G AAGTGTTGGGATTATAGGCATGAGC
+ 
 
n=
A/A=
A/G=
G/G=
G=
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
134
66
1
0
0.007
PMT-272
Exon 17: 3UTRPDE
19481785 GRCh37
19422377 NCBI36
2718 
TGCCCTCCCAAAGTGTTGGGATTAT A → G GGCATGAGCCACCACGACTGGCCAG
+ 
 
n=
A/A=
A/G=
G/G=
G=
136
63
5
0
0.037
136
53
15
0
0.110
136
68
0
0
0.000
134
59
6
2
0.075
PMT-272
Exon 17: 3UTRPDE
19481791 GRCh37
19422383 NCBI36
2724 
CCCAAAGTGTTGGGATTATAGGCAT G → C AGCCACCACGACTGGCCAGAGGACA
+ 
 
n=
G/G=
G/C=
C/C=
C=
136
68
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
134
67
0
0
0.000
PMT-272
Exon 17: 3UTRPDE
19482147 GRCh37
19422739 NCBI36
3080 
AGCTCTAGGAATAATTTTGCCTGCC C → T GGTTGCTCACCAGTTGTAGCTTGCC
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
66
2
0
0.015
134
67
0
0
0.000
134
67
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 17: 3UTRPDE
19482176 GRCh37
19422768 NCBI36
3109 
TGCTCACCAGTTGTAGCTTGCCAGC T → A CCCAACACCCTTCCTGGTGCCAATA
+ 
 
n=
T/T=
T/A=
A/A=
A=
136
64
4
0
0.029
134
67
0
0
0.000
134
62
5
0
0.037
136
68
0
0
0.000
PMT-272
Exon 17: 3UTRPDE
19482177 GRCh37
19422769 NCBI36
3110 
GCTCACCAGTTGTAGCTTGCCAGCT C → A CCAACACCCTTCCTGGTGCCAATAA
+ 
 
n=
C/C=
C/A=
A/A=
A=
136
64
4
0
0.029
134
67
0
0
0.000
134
62
5
0
0.037
136
68
0
0
0.000
PMT-272
Exon 17: 3UTRPDE
19482181 GRCh37
19422773 NCBI36
3114 
ACCAGTTGTAGCTTGCCAGCTCCCA A → G CACCCTTCCTGGTGCCAATAAACTT
+ 
 
n=
A/A=
A/G=
G/G=
G=
136
38
25
5
0.257
134
42
21
4
0.216
134
36
25
6
0.276
136
49
17
2
0.154
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.